EMAIL THIS PAGE TO A FRIEND

KRTAP13-4

keratin associated protein 13-4

14 Gene Product Result for
Synonyms: KAP13.4
Species: Human KRTAP13-4(284827)
UniProtKB ID: Q3LI77, A2RRL3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301995 ANTI-KRTAP13-4 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181600 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160671 MISSION® esiRNA esiRNA human KRTAP13-4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181600 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099903 predicted 233
2 SASI_Hs01_00099904 predicted 231
3 SASI_Hs01_00099906 predicted 246
4 SASI_Hs01_00099907 predicted 217
5 SASI_Hs01_00099908 predicted 204
6 SASI_Hs01_00099909 predicted 231
7 SASI_Hs01_00099910 predicted 211
8 SASI_Hs01_00099902 predicted 221
9 SASI_Hs01_00099905 predicted 209
10 SASI_Hs01_00099911 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181600
KRTAP13-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 13-4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-442s21c1
Sequence:CCGGAGACCAATCTGTGGATCTCGCCTCGAGGCGAGATCCACAGATTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-248s21c1
Sequence:CCGGGATCTCTAGGCTTTCGGTCCACTCGAGTGGACCGAAAGCCTAGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-389s21c1
Sequence:CCGGGATTCTGCTACCCAAACTACTCTCGAGAGTAGTTTGGGTAGCAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-300s1c1
Sequence:CCGGGTGCTGCTACTCGCTGGGAAACTCGAGTTTCCCAGCGAGTAGCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-332s1c1
Sequence:CCGGGCTTCAGATTCCTGAAATATGCTCGAGCATATTTCAGGAATCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-281s1c1
Sequence:CCGGCCCAGGGCTATGGATCTAGGTCTCGAGACCTAGATCCATAGCCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-138s1c1
Sequence:CCGGTCTCTACAGGGACTGTCAGAACTCGAGTTCTGACAGTCCCTGTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-230s1c1
Sequence:CCGGGTCAGACGACTTGCTCTGGATCTCGAGATCCAGAGCAAGTCGTCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181600
KRTAP13-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 13-4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-442s21c1
Sequence:CCGGAGACCAATCTGTGGATCTCGCCTCGAGGCGAGATCCACAGATTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-248s21c1
Sequence:CCGGGATCTCTAGGCTTTCGGTCCACTCGAGTGGACCGAAAGCCTAGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-389s21c1
Sequence:CCGGGATTCTGCTACCCAAACTACTCTCGAGAGTAGTTTGGGTAGCAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-300s1c1
Sequence:CCGGGTGCTGCTACTCGCTGGGAAACTCGAGTTTCCCAGCGAGTAGCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-332s1c1
Sequence:CCGGGCTTCAGATTCCTGAAATATGCTCGAGCATATTTCAGGAATCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-281s1c1
Sequence:CCGGCCCAGGGCTATGGATCTAGGTCTCGAGACCTAGATCCATAGCCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-138s1c1
Sequence:CCGGTCTCTACAGGGACTGTCAGAACTCGAGTTCTGACAGTCCCTGTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-230s1c1
Sequence:CCGGGTCAGACGACTTGCTCTGGATCTCGAGATCCAGAGCAAGTCGTCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181600
KRTAP13-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 13-4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-442s21c1
Sequence:CCGGAGACCAATCTGTGGATCTCGCCTCGAGGCGAGATCCACAGATTGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-248s21c1
Sequence:CCGGGATCTCTAGGCTTTCGGTCCACTCGAGTGGACCGAAAGCCTAGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181600.1-389s21c1
Sequence:CCGGGATTCTGCTACCCAAACTACTCTCGAGAGTAGTTTGGGTAGCAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-300s1c1
Sequence:CCGGGTGCTGCTACTCGCTGGGAAACTCGAGTTTCCCAGCGAGTAGCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-332s1c1
Sequence:CCGGGCTTCAGATTCCTGAAATATGCTCGAGCATATTTCAGGAATCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-281s1c1
Sequence:CCGGCCCAGGGCTATGGATCTAGGTCTCGAGACCTAGATCCATAGCCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-138s1c1
Sequence:CCGGTCTCTACAGGGACTGTCAGAACTCGAGTTCTGACAGTCCCTGTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181600.1-230s1c1
Sequence:CCGGGTCAGACGACTTGCTCTGGATCTCGAGATCCAGAGCAAGTCGTCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)