EMAIL THIS PAGE TO A FRIEND

KRTAP15-1

keratin associated protein 15-1

26 Gene Product Result for
Synonyms: KAP15.1
UniProtKB ID: Q3LI76, Q2M3F4
Gene ID:
Rat(288297) keratin associated protein 15-1
Goat(100861176) keratin associated protein 15-1
cow(785090) keratin associated protein 15-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181623 Rosetta Predictions human pricing
NM_001105896 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172906 predicted 212
2 SASI_Hs01_00172907 predicted 213
3 SASI_Hs01_00172908 predicted 208
4 SASI_Hs01_00172909 predicted 213
5 SASI_Hs01_00172911 predicted 206
6 SASI_Hs01_00172912 predicted 213
7 SASI_Hs01_00172913 predicted 215
8 SASI_Hs01_00172910 predicted 201
9 SASI_Hs01_00172914 predicted 277
10 SASI_Hs01_00172915 predicted 50
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213602 predicted 403
2 SASI_Rn02_00213603 predicted 333
3 SASI_Rn02_00213604 predicted 222
4 SASI_Rn02_00213605 predicted 544
5 SASI_Rn02_00213606 predicted 582
6 SASI_Rn02_00213607 predicted 602
7 SASI_Rn02_00213608 predicted 309
8 SASI_Rn02_00213609 predicted 366
9 SASI_Rn02_00213610 predicted 447
10 SASI_Rn02_00213611 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181623
KRTAP15-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 15-1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-257s1c1
Sequence:CCGGCCCGCCAGACTAACTACATAACTCGAGTTATGTAGTTAGTCTGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-216s1c1
Sequence:CCGGGACATCCTGTTACTGCCCAAACTCGAGTTTGGGCAGTAACAGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-60s1c1
Sequence:CCGGGTATCCAGTTTCCACTTATAACTCGAGTTATAAGTGGAAACTGGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-96s1c1
Sequence:CCGGCAATGCCATCTATTCTCCAAACTCGAGTTTGGAGAATAGATGGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-269s1c1
Sequence:CCGGACTACATAAGATCCCTTGGATCTCGAGATCCAAGGGATCTTATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-128s21c1
Sequence:CCGGTGGGCTCCTCTCTCTACAATGCTCGAGCATTGTAGAGAGAGGAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-390s21c1
Sequence:CCGGGAATTTCCAGGCAACTTGTTACTCGAGTAACAAGTTGCCTGGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-325s21c1
Sequence:CCGGAGCACTGGCTTCCAATCTCTGCTCGAGCAGAGATTGGAAGCCAGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-296s21c1
Sequence:CCGGACACTGGCCTTGGATCTCTTGCTCGAGCAAGAGATCCAAGGCCAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181623
KRTAP15-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 15-1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-257s1c1
Sequence:CCGGCCCGCCAGACTAACTACATAACTCGAGTTATGTAGTTAGTCTGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-216s1c1
Sequence:CCGGGACATCCTGTTACTGCCCAAACTCGAGTTTGGGCAGTAACAGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-60s1c1
Sequence:CCGGGTATCCAGTTTCCACTTATAACTCGAGTTATAAGTGGAAACTGGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-96s1c1
Sequence:CCGGCAATGCCATCTATTCTCCAAACTCGAGTTTGGAGAATAGATGGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-269s1c1
Sequence:CCGGACTACATAAGATCCCTTGGATCTCGAGATCCAAGGGATCTTATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-128s21c1
Sequence:CCGGTGGGCTCCTCTCTCTACAATGCTCGAGCATTGTAGAGAGAGGAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-390s21c1
Sequence:CCGGGAATTTCCAGGCAACTTGTTACTCGAGTAACAAGTTGCCTGGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-325s21c1
Sequence:CCGGAGCACTGGCTTCCAATCTCTGCTCGAGCAGAGATTGGAAGCCAGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-296s21c1
Sequence:CCGGACACTGGCCTTGGATCTCTTGCTCGAGCAAGAGATCCAAGGCCAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181623
KRTAP15-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 15-1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-257s1c1
Sequence:CCGGCCCGCCAGACTAACTACATAACTCGAGTTATGTAGTTAGTCTGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-216s1c1
Sequence:CCGGGACATCCTGTTACTGCCCAAACTCGAGTTTGGGCAGTAACAGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-60s1c1
Sequence:CCGGGTATCCAGTTTCCACTTATAACTCGAGTTATAAGTGGAAACTGGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-96s1c1
Sequence:CCGGCAATGCCATCTATTCTCCAAACTCGAGTTTGGAGAATAGATGGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181623.1-269s1c1
Sequence:CCGGACTACATAAGATCCCTTGGATCTCGAGATCCAAGGGATCTTATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-128s21c1
Sequence:CCGGTGGGCTCCTCTCTCTACAATGCTCGAGCATTGTAGAGAGAGGAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-390s21c1
Sequence:CCGGGAATTTCCAGGCAACTTGTTACTCGAGTAACAAGTTGCCTGGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-325s21c1
Sequence:CCGGAGCACTGGCTTCCAATCTCTGCTCGAGCAGAGATTGGAAGCCAGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181623.1-296s21c1
Sequence:CCGGACACTGGCCTTGGATCTCTTGCTCGAGCAAGAGATCCAAGGCCAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)