EMAIL THIS PAGE TO A FRIEND

KRTAP16-1

keratin associated protein 16-1

11 Gene Product Result for
Synonyms: KAP16.1
UniProtKB ID: A8MUX0
Gene ID:
Mouse(170651) keratin associated protein 16-1
Rat(100362207) keratin associated protein 16-1
dog(100684772) keratin associated protein 16-1
cow(788650) keratin associated protein 16-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA070954 Anti-KRTAP16-1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155379 predicted 528
2 SASI_Mm01_00155380 predicted 507
3 SASI_Mm01_00155381 predicted 440
4 SASI_Mm01_00155382 predicted 504
5 SASI_Mm01_00155383 predicted 522
6 SASI_Mm01_00155384 predicted 475
7 SASI_Mm01_00155385 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130870
KRTAP16-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 16-1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-339s21c1
Sequence:CCGGGGCTTTGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-153s21c1
Sequence:CCGGTATGGAGGCTTTGGAGGCTTTCTCGAGAAAGCCTCCAAAGCCTCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-312s21c1
Sequence:CCGGGGCTATGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-123s21c1
Sequence:CCGGGGCTATGGAGGCTTCGGATATCTCGAGATATCCGAAGCCTCCATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-423s21c1
Sequence:CCGGTTCTCCAGTTTCTACTGAAATCTCGAGATTTCAGTAGAAACTGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130870.1-170s1c1
Sequence:CCGGCTTTGGATATGGCTCTGGCTACTCGAGTAGCCAGAGCCATATCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130870
KRTAP16-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 16-1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-339s21c1
Sequence:CCGGGGCTTTGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-153s21c1
Sequence:CCGGTATGGAGGCTTTGGAGGCTTTCTCGAGAAAGCCTCCAAAGCCTCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-312s21c1
Sequence:CCGGGGCTATGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-123s21c1
Sequence:CCGGGGCTATGGAGGCTTCGGATATCTCGAGATATCCGAAGCCTCCATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-423s21c1
Sequence:CCGGTTCTCCAGTTTCTACTGAAATCTCGAGATTTCAGTAGAAACTGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130870.1-170s1c1
Sequence:CCGGCTTTGGATATGGCTCTGGCTACTCGAGTAGCCAGAGCCATATCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130870
KRTAP16-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 16-1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-339s21c1
Sequence:CCGGGGCTTTGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-153s21c1
Sequence:CCGGTATGGAGGCTTTGGAGGCTTTCTCGAGAAAGCCTCCAAAGCCTCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-312s21c1
Sequence:CCGGGGCTATGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-123s21c1
Sequence:CCGGGGCTATGGAGGCTTCGGATATCTCGAGATATCCGAAGCCTCCATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130870.1-423s21c1
Sequence:CCGGTTCTCCAGTTTCTACTGAAATCTCGAGATTTCAGTAGAAACTGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130870.1-170s1c1
Sequence:CCGGCTTTGGATATGGCTCTGGCTACTCGAGTAGCCAGAGCCATATCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)