EMAIL THIS PAGE TO A FRIEND

KRTAP17-1

keratin associated protein 17-1

70 Gene Product Result for
Synonyms: KAP17.1 KRTAP16.1 KRTAP17.1
UniProtKB ID: Q9BYP8
Gene ID:
Human(83902) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(77914) keratin associated protein 17-1
Rat(680508) keratin associated protein 17-1
cow(100297004) keratin associated protein 17-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031964 Rosetta Predictions human pricing
XM_001057494 Rosetta Predictions rat pricing
NM_001099774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178555 predicted 545
2 SASI_Hs01_00178556 predicted 502
3 SASI_Hs01_00178557 predicted 526
4 SASI_Hs01_00178558 predicted 540
5 SASI_Hs01_00178559 predicted 525
6 SASI_Hs01_00178560 predicted 542
7 SASI_Hs01_00178561 predicted 541
8 SASI_Hs01_00178562 predicted 505
9 SASI_Hs01_00178563 predicted 539
10 SASI_Hs01_00178564 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286577 predicted 271
2 SASI_Rn02_00286578 predicted 6
3 SASI_Rn02_00286579 predicted 277
4 SASI_Rn02_00286580 predicted 7
5 SASI_Rn02_00286581 predicted 7
6 SASI_Rn02_00286582 predicted 16
7 SASI_Rn02_00286583 predicted 14
8 SASI_Rn02_00286584 predicted 27
9 SASI_Rn02_00286585 predicted 276
10 SASI_Rn02_00286586 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302015 predicted 482
2 SASI_Mm02_00302016 predicted 358
3 SASI_Mm02_00302017 predicted 501
4 SASI_Mm02_00302018 predicted 295
5 SASI_Mm02_00302019 predicted 230
6 SASI_Mm02_00302020 predicted 419
7 SASI_Mm02_00302021 predicted 451
8 SASI_Mm02_00302022 predicted 327
9 SASI_Mm02_00302023 predicted 528
10 SASI_Mm02_00302024 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031964
KRTAP17-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 17-1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031964.1-205s21c1
Sequence:CCGGGGATCGTCTTGCTGTGGATCTCTCGAGAGATCCACAGCAAGACGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031964.1-280s21c1
Sequence:CCGGAGTTGCTGTGGGTCCAGTTGCCTCGAGGCAACTGGACCCACAGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031964.1-636s21c1
Sequence:CCGGTTCAATGTCTTGTACTATAAGCTCGAGCTTATAGTACAAGACATTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-573s1c1
Sequence:CCGGGTCACAACTAAGTGATCCCAACTCGAGTTGGGATCACTTAGTTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-539s1c1
Sequence:CCGGCAAGAGCCATACTCTGATGAACTCGAGTTCATCAGAGTATGGCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031964.1-339s1c1
Sequence:CCGGCACACCTATATGCGACACAAACTCGAGTTTGTGTCGCATATAGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-544s1c1
Sequence:CCGGGCCATACTCTGATGAAACATTCTCGAGAATGTTTCATCAGAGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-455s1c1
Sequence:CCGGCCAAGACAGTGTCTTGTCTTTCTCGAGAAAGACAAGACACTGTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031964
KRTAP17-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 17-1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031964.1-205s21c1
Sequence:CCGGGGATCGTCTTGCTGTGGATCTCTCGAGAGATCCACAGCAAGACGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031964.1-280s21c1
Sequence:CCGGAGTTGCTGTGGGTCCAGTTGCCTCGAGGCAACTGGACCCACAGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031964.1-636s21c1
Sequence:CCGGTTCAATGTCTTGTACTATAAGCTCGAGCTTATAGTACAAGACATTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-573s1c1
Sequence:CCGGGTCACAACTAAGTGATCCCAACTCGAGTTGGGATCACTTAGTTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-539s1c1
Sequence:CCGGCAAGAGCCATACTCTGATGAACTCGAGTTCATCAGAGTATGGCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031964.1-339s1c1
Sequence:CCGGCACACCTATATGCGACACAAACTCGAGTTTGTGTCGCATATAGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-544s1c1
Sequence:CCGGGCCATACTCTGATGAAACATTCTCGAGAATGTTTCATCAGAGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-455s1c1
Sequence:CCGGCCAAGACAGTGTCTTGTCTTTCTCGAGAAAGACAAGACACTGTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031964
KRTAP17-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 17-1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031964.1-205s21c1
Sequence:CCGGGGATCGTCTTGCTGTGGATCTCTCGAGAGATCCACAGCAAGACGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031964.1-280s21c1
Sequence:CCGGAGTTGCTGTGGGTCCAGTTGCCTCGAGGCAACTGGACCCACAGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031964.1-636s21c1
Sequence:CCGGTTCAATGTCTTGTACTATAAGCTCGAGCTTATAGTACAAGACATTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-573s1c1
Sequence:CCGGGTCACAACTAAGTGATCCCAACTCGAGTTGGGATCACTTAGTTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-539s1c1
Sequence:CCGGCAAGAGCCATACTCTGATGAACTCGAGTTCATCAGAGTATGGCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031964.1-339s1c1
Sequence:CCGGCACACCTATATGCGACACAAACTCGAGTTTGTGTCGCATATAGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-544s1c1
Sequence:CCGGGCCATACTCTGATGAAACATTCTCGAGAATGTTTCATCAGAGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031964.1-455s1c1
Sequence:CCGGCCAAGACAGTGTCTTGTCTTTCTCGAGAAAGACAAGACACTGTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099774
KRTAP17-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 17-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-490s21c1
Sequence:CCGGGCGACATGCCTCTCCTGTTATCTCGAGATAACAGGAGAGGCATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-547s21c1
Sequence:CCGGTCAGGGCCAAAGAGCCATTTCCTCGAGGAAATGGCTCTTTGGCCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-397s21c1
Sequence:CCGGCCTCTAACTGAGACAGTGTTGCTCGAGCAACACTGTCTCAGTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-459s21c1
Sequence:CCGGCATCTCCTGACTCGTTTGCACCTCGAGGTGCAAACGAGTCAGGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-587s21c1
Sequence:CCGGTGGGTTCCAATGAGGTGGTCACTCGAGTGACCACCTCATTGGAACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099774
KRTAP17-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 17-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-490s21c1
Sequence:CCGGGCGACATGCCTCTCCTGTTATCTCGAGATAACAGGAGAGGCATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-547s21c1
Sequence:CCGGTCAGGGCCAAAGAGCCATTTCCTCGAGGAAATGGCTCTTTGGCCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-397s21c1
Sequence:CCGGCCTCTAACTGAGACAGTGTTGCTCGAGCAACACTGTCTCAGTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-459s21c1
Sequence:CCGGCATCTCCTGACTCGTTTGCACCTCGAGGTGCAAACGAGTCAGGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-587s21c1
Sequence:CCGGTGGGTTCCAATGAGGTGGTCACTCGAGTGACCACCTCATTGGAACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099774
KRTAP17-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 17-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-490s21c1
Sequence:CCGGGCGACATGCCTCTCCTGTTATCTCGAGATAACAGGAGAGGCATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-547s21c1
Sequence:CCGGTCAGGGCCAAAGAGCCATTTCCTCGAGGAAATGGCTCTTTGGCCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-397s21c1
Sequence:CCGGCCTCTAACTGAGACAGTGTTGCTCGAGCAACACTGTCTCAGTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-459s21c1
Sequence:CCGGCATCTCCTGACTCGTTTGCACCTCGAGGTGCAAACGAGTCAGGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099774.1-587s21c1
Sequence:CCGGTGGGTTCCAATGAGGTGGTCACTCGAGTGACCACCTCATTGGAACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)