EMAIL THIS PAGE TO A FRIEND

KRTAP19-1

keratin associated protein 19-1

21 Gene Product Result for
Synonyms: KAP19.1
UniProtKB ID: Q8IUB9, A4QN27, Q3LI75
Gene ID:
Mouse(170657) keratin associated protein 19-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181607 Rosetta Predictions human pricing
NM_130876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116741 predicted 219
2 SASI_Hs01_00116742 predicted 225
3 SASI_Hs01_00116743 predicted 137
4 SASI_Hs01_00116744 predicted 22
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150996 predicted 243
2 SASI_Mm02_00338292 predicted 270
3 SASI_Mm02_00338293 predicted 256
4 SASI_Mm02_00338294 predicted 263
5 SASI_Mm02_00338295 predicted 250
6 SASI_Mm02_00338296 predicted 270
7 SASI_Mm02_00338297 predicted 369
8 SASI_Mm02_00338298 predicted 289
9 SASI_Mm02_00338299 predicted 330
10 SASI_Mm02_00338300 predicted 431
11 SASI_Mm01_00150995 predicted 263
12 SASI_Mm01_00150997 predicted 273
13 SASI_Mm01_00150998 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181607
VALIDATED
KRTAP19-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 19-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-145s21c1
Sequence:CCGGGGCTTTGGAAGCTACGGATATCTCGAGATATCCGTAGCTTCCAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-118s21c1
Sequence:CCGGGGCTATGGAGGCTACGGATATCTCGAGATATCCGTAGCCTCCATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-237s21c1
Sequence:CCGGGTACAATGGAGGATACGGATTCTCGAGAATCCGTATCCTCCATTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-172s21c1
Sequence:CCGGGGCTTTGGAGGCTACGGATATCTCGAGATATCCGTAGCCTCCAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-199s21c1
Sequence:CCGGGGCTTTGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181607
VALIDATED
KRTAP19-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 19-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-145s21c1
Sequence:CCGGGGCTTTGGAAGCTACGGATATCTCGAGATATCCGTAGCTTCCAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-118s21c1
Sequence:CCGGGGCTATGGAGGCTACGGATATCTCGAGATATCCGTAGCCTCCATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-237s21c1
Sequence:CCGGGTACAATGGAGGATACGGATTCTCGAGAATCCGTATCCTCCATTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-172s21c1
Sequence:CCGGGGCTTTGGAGGCTACGGATATCTCGAGATATCCGTAGCCTCCAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-199s21c1
Sequence:CCGGGGCTTTGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181607
VALIDATED
KRTAP19-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 19-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-145s21c1
Sequence:CCGGGGCTTTGGAAGCTACGGATATCTCGAGATATCCGTAGCTTCCAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-118s21c1
Sequence:CCGGGGCTATGGAGGCTACGGATATCTCGAGATATCCGTAGCCTCCATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-237s21c1
Sequence:CCGGGTACAATGGAGGATACGGATTCTCGAGAATCCGTATCCTCCATTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-172s21c1
Sequence:CCGGGGCTTTGGAGGCTACGGATATCTCGAGATATCCGTAGCCTCCAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181607.1-199s21c1
Sequence:CCGGGGCTTTGGAGGCTATGGATATCTCGAGATATCCATAGCCTCCAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130876
KRTAP19-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 19-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-284s21c1
Sequence:CCGGTGCTGTAATTAGAAGTAAACACTCGAGTGTTTACTTCTAATTACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130876.3-248s21c1
Sequence:CCGGGGAAGATATGGGTTCTCCAACCTCGAGGTTGGAGAACCCATATCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-313s21c1
Sequence:CCGGGGAAATACTTGTCGTCCTGTTCTCGAGAACAGGACGACAAGTATTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130876.3-272s21c1
Sequence:CCGGTACTGAGTGAATTGCTGTAATCTCGAGATTACAGCAATTCACTCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-298s21c1
Sequence:CCGGGTAAACACGGGACTTGGAAATCTCGAGATTTCCAAGTCCCGTGTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130876
KRTAP19-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 19-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-284s21c1
Sequence:CCGGTGCTGTAATTAGAAGTAAACACTCGAGTGTTTACTTCTAATTACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130876.3-248s21c1
Sequence:CCGGGGAAGATATGGGTTCTCCAACCTCGAGGTTGGAGAACCCATATCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-313s21c1
Sequence:CCGGGGAAATACTTGTCGTCCTGTTCTCGAGAACAGGACGACAAGTATTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130876.3-272s21c1
Sequence:CCGGTACTGAGTGAATTGCTGTAATCTCGAGATTACAGCAATTCACTCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-298s21c1
Sequence:CCGGGTAAACACGGGACTTGGAAATCTCGAGATTTCCAAGTCCCGTGTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130876
KRTAP19-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 19-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-284s21c1
Sequence:CCGGTGCTGTAATTAGAAGTAAACACTCGAGTGTTTACTTCTAATTACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130876.3-248s21c1
Sequence:CCGGGGAAGATATGGGTTCTCCAACCTCGAGGTTGGAGAACCCATATCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-313s21c1
Sequence:CCGGGGAAATACTTGTCGTCCTGTTCTCGAGAACAGGACGACAAGTATTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130876.3-272s21c1
Sequence:CCGGTACTGAGTGAATTGCTGTAATCTCGAGATTACAGCAATTCACTCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130876.3-298s21c1
Sequence:CCGGGTAAACACGGGACTTGGAAATCTCGAGATTTCCAAGTCCCGTGTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)