EMAIL THIS PAGE TO A FRIEND

KRTAP19-4

keratin associated protein 19-4

29 Gene Product Result for
Synonyms: KAP19.4
UniProtKB ID: Q3LI73, Q17RT4, Q17RT6
Gene ID:
Mouse(170654) keratin associated protein 19-4
dog(609382) keratin associated protein 19-4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181610 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181610 Rosetta Predictions human pricing
NM_130873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102987 predicted 214
2 SASI_Hs01_00102988 predicted 95
3 SASI_Hs01_00102989 predicted 195
4 SASI_Hs01_00102990 predicted 157
5 SASI_Hs01_00102991 predicted 203
6 SASI_Hs01_00102992 predicted 157
7 SASI_Hs01_00102994 predicted 209
8 SASI_Hs01_00102996 predicted 171
9 SASI_Hs02_00370201 predicted 162
10 SASI_Hs02_00370202 predicted 209
11 SASI_Hs01_00102993 predicted 178
12 SASI_Hs01_00102995 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175988 predicted 267
2 SASI_Mm02_00338291 predicted 119
3 SASI_Mm01_00175989 predicted 251
4 SASI_Mm01_00175990 predicted 115
5 SASI_Mm01_00175991 predicted 260
6 SASI_Mm01_00175992 predicted 120
7 SASI_Mm01_00175993 predicted 54
8 SASI_Mm01_00175994 predicted 100
9 SASI_Mm01_00175996 predicted 259
10 SASI_Mm01_00175997 predicted 54
11 SASI_Mm01_00175995 predicted 125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130873
KRTAP19-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 19-4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000247836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-125s21c1
Sequence:CCGGACTGGGCTATGGTTGTGGCTTCTCGAGAAGCCACAACCATAGCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130873.1-280s21c1
Sequence:CCGGAGGCTGAACTGGGAAAGCAACCTCGAGGTTGCTTTCCCAGTTCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-270s21c1
Sequence:CCGGTTCTACTGAAAGGCTGAACTGCTCGAGCAGTTCAGCCTTTCAGTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-261s21c1
Sequence:CCGGTTCTCCACCTTCTACTGAAAGCTCGAGCTTTCAGTAGAAGGTGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130873
KRTAP19-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 19-4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000247836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-125s21c1
Sequence:CCGGACTGGGCTATGGTTGTGGCTTCTCGAGAAGCCACAACCATAGCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130873.1-280s21c1
Sequence:CCGGAGGCTGAACTGGGAAAGCAACCTCGAGGTTGCTTTCCCAGTTCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-270s21c1
Sequence:CCGGTTCTACTGAAAGGCTGAACTGCTCGAGCAGTTCAGCCTTTCAGTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-261s21c1
Sequence:CCGGTTCTCCACCTTCTACTGAAAGCTCGAGCTTTCAGTAGAAGGTGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130873
KRTAP19-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 19-4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000247836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-125s21c1
Sequence:CCGGACTGGGCTATGGTTGTGGCTTCTCGAGAAGCCACAACCATAGCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130873.1-280s21c1
Sequence:CCGGAGGCTGAACTGGGAAAGCAACCTCGAGGTTGCTTTCCCAGTTCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-270s21c1
Sequence:CCGGTTCTACTGAAAGGCTGAACTGCTCGAGCAGTTCAGCCTTTCAGTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130873.1-261s21c1
Sequence:CCGGTTCTCCACCTTCTACTGAAAGCTCGAGCTTTCAGTAGAAGGTGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181610
KRTAP19-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 19-4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000243212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-194s21c1
Sequence:CCGGCCTACCCTGAGGACACGATATCTCGAGATATCGTGTCCTCAGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-219s21c1
Sequence:CCGGGGTCATAAGAAGATCATTCAACTCGAGTTGAATGATCTTCTTATGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-207s21c1
Sequence:CCGGCACGATATCAGAGGTCATAAGCTCGAGCTTATGACCTCTGATATCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-173s21c1
Sequence:CCGGGATTCTCAATTCTACTGAAATCTCGAGATTTCAGTAGAATTGAGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181610
KRTAP19-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 19-4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000243212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-194s21c1
Sequence:CCGGCCTACCCTGAGGACACGATATCTCGAGATATCGTGTCCTCAGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-219s21c1
Sequence:CCGGGGTCATAAGAAGATCATTCAACTCGAGTTGAATGATCTTCTTATGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-207s21c1
Sequence:CCGGCACGATATCAGAGGTCATAAGCTCGAGCTTATGACCTCTGATATCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-173s21c1
Sequence:CCGGGATTCTCAATTCTACTGAAATCTCGAGATTTCAGTAGAATTGAGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181610
KRTAP19-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 19-4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000243212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-194s21c1
Sequence:CCGGCCTACCCTGAGGACACGATATCTCGAGATATCGTGTCCTCAGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-219s21c1
Sequence:CCGGGGTCATAAGAAGATCATTCAACTCGAGTTGAATGATCTTCTTATGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-207s21c1
Sequence:CCGGCACGATATCAGAGGTCATAAGCTCGAGCTTATGACCTCTGATATCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181610.1-173s21c1
Sequence:CCGGGATTCTCAATTCTACTGAAATCTCGAGATTTCAGTAGAATTGAGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)