EMAIL THIS PAGE TO A FRIEND

KRTAP19-5

keratin associated protein 19-5

39 Gene Product Result for
Synonyms: KAP19.5
UniProtKB ID: Q3LI72, A4IF22
Gene ID:
Mouse(16704) keratin associated protein 19-5
Rat(685304) keratin associated protein 19-5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181611 Rosetta Predictions human pricing
XM_001063234 Rosetta Predictions rat pricing
NM_010676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045782 predicted 47
2 SASI_Hs01_00045783 predicted 163
3 SASI_Hs01_00045784 predicted 40
4 SASI_Hs01_00045785 predicted 159
5 SASI_Hs01_00045786 predicted 34
6 SASI_Hs01_00045787 predicted 104
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306337 predicted 46
2 SASI_Rn02_00306338 predicted 114
3 SASI_Rn02_00306339 predicted 130
4 SASI_Rn02_00306340 predicted 45
5 SASI_Rn02_00306341 predicted 41
6 SASI_Rn02_00306342 predicted 54
7 SASI_Rn02_00306343 predicted 44
8 SASI_Rn02_00306344 predicted 57
9 SASI_Rn02_00306345 predicted 125
10 SASI_Rn02_00306346 predicted 113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191143 predicted 218
2 SASI_Mm01_00191144 predicted 199
3 SASI_Mm01_00191145 predicted 220
4 SASI_Mm01_00191146 predicted 226
5 SASI_Mm01_00191147 predicted 223
6 SASI_Mm01_00191148 predicted 221
7 SASI_Mm01_00191149 predicted 205
8 SASI_Mm01_00191150 predicted 195
9 SASI_Mm02_00319108 predicted 253
10 SASI_Mm02_00319109 predicted 224
11 SASI_Mm01_00191142 predicted 205
12 SASI_Mm01_00191151 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010676
KRTAP19-5 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 19-5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-190s21c1
Sequence:CCGGGGATATGGATTCTCCCGATTCCTCGAGGAATCGGGAGAATCCATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010676.1-244s1c1
Sequence:CCGGGCCAGCATCTTAAATATGAAACTCGAGTTTCATATTTAAGATGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-118s21c1
Sequence:CCGGTTTGGAGGTTACGGATATGGACTCGAGTCCATATCCGTAACCTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010676.2-225s21c1
Sequence:CCGGCCAGAGGAGCCAGCATCTTAACTCGAGTTAAGATGCTGGCTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-149s21c1
Sequence:CCGGGCAGATATGGATATGGCTACCCTCGAGGGTAGCCATATCCATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010676.2-176s1c1
Sequence:CCGGCCCTTTATTATGGAGGATATGCTCGAGCATATCCTCCATAATAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-77s21c1
Sequence:CCGGGCTTTGGGAACCTGGGTTATGCTCGAGCATAACCCAGGTTCCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010676.1-151s1c1
Sequence:CCGGCTGGCTATGGCAGATATGGATCTCGAGATCCATATCTGCCATAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010676
KRTAP19-5 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 19-5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-190s21c1
Sequence:CCGGGGATATGGATTCTCCCGATTCCTCGAGGAATCGGGAGAATCCATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010676.1-244s1c1
Sequence:CCGGGCCAGCATCTTAAATATGAAACTCGAGTTTCATATTTAAGATGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-118s21c1
Sequence:CCGGTTTGGAGGTTACGGATATGGACTCGAGTCCATATCCGTAACCTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010676.2-225s21c1
Sequence:CCGGCCAGAGGAGCCAGCATCTTAACTCGAGTTAAGATGCTGGCTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-149s21c1
Sequence:CCGGGCAGATATGGATATGGCTACCCTCGAGGGTAGCCATATCCATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010676.2-176s1c1
Sequence:CCGGCCCTTTATTATGGAGGATATGCTCGAGCATATCCTCCATAATAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-77s21c1
Sequence:CCGGGCTTTGGGAACCTGGGTTATGCTCGAGCATAACCCAGGTTCCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010676.1-151s1c1
Sequence:CCGGCTGGCTATGGCAGATATGGATCTCGAGATCCATATCTGCCATAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010676
KRTAP19-5 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 19-5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-190s21c1
Sequence:CCGGGGATATGGATTCTCCCGATTCCTCGAGGAATCGGGAGAATCCATATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010676.1-244s1c1
Sequence:CCGGGCCAGCATCTTAAATATGAAACTCGAGTTTCATATTTAAGATGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-118s21c1
Sequence:CCGGTTTGGAGGTTACGGATATGGACTCGAGTCCATATCCGTAACCTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010676.2-225s21c1
Sequence:CCGGCCAGAGGAGCCAGCATCTTAACTCGAGTTAAGATGCTGGCTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-149s21c1
Sequence:CCGGGCAGATATGGATATGGCTACCCTCGAGGGTAGCCATATCCATATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010676.2-176s1c1
Sequence:CCGGCCCTTTATTATGGAGGATATGCTCGAGCATATCCTCCATAATAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010676.2-77s21c1
Sequence:CCGGGCTTTGGGAACCTGGGTTATGCTCGAGCATAACCCAGGTTCCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010676.1-151s1c1
Sequence:CCGGCTGGCTATGGCAGATATGGATCTCGAGATCCATATCTGCCATAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181611
KRTAP19-5 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 19-5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-193s21c1
Sequence:CCGGGGATATGGATTCTCTGGATTTCTCGAGAAATCCAGAGAATCCATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-56s21c1
Sequence:CCGGATGACCTGGGCTATGGCTATGCTCGAGCATAGCCATAGCCCAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-144s21c1
Sequence:CCGGTGGCTTCGGAGGCTATGGATACTCGAGTATCCATAGCCTCCGAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-178s21c1
Sequence:CCGGCCATCATGCTATGGAGGATATCTCGAGATATCCTCCATAGCATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-42s21c1
Sequence:CCGGCTACGGAGGCTTCGATGACCTCTCGAGAGGTCATCGAAGCCTCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181611
KRTAP19-5 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 19-5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-193s21c1
Sequence:CCGGGGATATGGATTCTCTGGATTTCTCGAGAAATCCAGAGAATCCATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-56s21c1
Sequence:CCGGATGACCTGGGCTATGGCTATGCTCGAGCATAGCCATAGCCCAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-144s21c1
Sequence:CCGGTGGCTTCGGAGGCTATGGATACTCGAGTATCCATAGCCTCCGAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-178s21c1
Sequence:CCGGCCATCATGCTATGGAGGATATCTCGAGATATCCTCCATAGCATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-42s21c1
Sequence:CCGGCTACGGAGGCTTCGATGACCTCTCGAGAGGTCATCGAAGCCTCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181611
KRTAP19-5 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 19-5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-193s21c1
Sequence:CCGGGGATATGGATTCTCTGGATTTCTCGAGAAATCCAGAGAATCCATATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-56s21c1
Sequence:CCGGATGACCTGGGCTATGGCTATGCTCGAGCATAGCCATAGCCCAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-144s21c1
Sequence:CCGGTGGCTTCGGAGGCTATGGATACTCGAGTATCCATAGCCTCCGAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-178s21c1
Sequence:CCGGCCATCATGCTATGGAGGATATCTCGAGATATCCTCCATAGCATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181611.1-42s21c1
Sequence:CCGGCTACGGAGGCTTCGATGACCTCTCGAGAGGTCATCGAAGCCTCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)