EMAIL THIS PAGE TO A FRIEND

KRTAP19-6

keratin associated protein 19-6

13 Gene Product Result for
Synonyms: KAP19.6
Species: Human KRTAP19-6(337973)
UniProtKB ID: Q3LI70, Q3LI71
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181612 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181612 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158823 predicted 172
2 SASI_Hs01_00158824 predicted 159
3 SASI_Hs01_00158825 predicted 163
4 SASI_Hs01_00158826 predicted 33
5 SASI_Hs01_00158828 predicted 104
6 SASI_Hs01_00158829 predicted 207
7 SASI_Hs01_00158830 predicted 206
8 SASI_Hs01_00158831 predicted 159
9 SASI_Hs01_00158832 predicted 240
10 SASI_Hs02_00370203 predicted 234
11 SASI_Hs01_00158827 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181612
KRTAP19-6 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 19-6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181612.2-172s1c1
Sequence:CCGGGCCGTGAAGGTTATGGATTCTCTCGAGAGAATCCATAACCTTCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-105s21c1
Sequence:CCGGGGCTGTGGAGGCTACAGATATCTCGAGATATCTGTAGCCTCCACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-35s21c1
Sequence:CCGGATACTATGGCAGCTACTACAGCTCGAGCTGTAGTAGCTGCCATAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-132s21c1
Sequence:CCGGGGCTATGGAGGCTATAGATATCTCGAGATATCTATAGCCTCCATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-64s21c1
Sequence:CCGGGATATGGCTGTGGAGGCTTTGCTCGAGCAAAGCCTCCACAGCCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-172s21c1
Sequence:CCGGGCCGTGAAGGTTATGGATTCTCTCGAGAGAATCCATAACCTTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181612
KRTAP19-6 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 19-6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181612.2-172s1c1
Sequence:CCGGGCCGTGAAGGTTATGGATTCTCTCGAGAGAATCCATAACCTTCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-105s21c1
Sequence:CCGGGGCTGTGGAGGCTACAGATATCTCGAGATATCTGTAGCCTCCACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-35s21c1
Sequence:CCGGATACTATGGCAGCTACTACAGCTCGAGCTGTAGTAGCTGCCATAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-132s21c1
Sequence:CCGGGGCTATGGAGGCTATAGATATCTCGAGATATCTATAGCCTCCATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-64s21c1
Sequence:CCGGGATATGGCTGTGGAGGCTTTGCTCGAGCAAAGCCTCCACAGCCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-172s21c1
Sequence:CCGGGCCGTGAAGGTTATGGATTCTCTCGAGAGAATCCATAACCTTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181612
KRTAP19-6 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 19-6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181612.2-172s1c1
Sequence:CCGGGCCGTGAAGGTTATGGATTCTCTCGAGAGAATCCATAACCTTCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-105s21c1
Sequence:CCGGGGCTGTGGAGGCTACAGATATCTCGAGATATCTGTAGCCTCCACAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-35s21c1
Sequence:CCGGATACTATGGCAGCTACTACAGCTCGAGCTGTAGTAGCTGCCATAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-132s21c1
Sequence:CCGGGGCTATGGAGGCTATAGATATCTCGAGATATCTATAGCCTCCATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-64s21c1
Sequence:CCGGGATATGGCTGTGGAGGCTTTGCTCGAGCAAAGCCTCCACAGCCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181612.2-172s21c1
Sequence:CCGGGCCGTGAAGGTTATGGATTCTCTCGAGAGAATCCATAACCTTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)