EMAIL THIS PAGE TO A FRIEND

KRTAP19-8

keratin associated protein 19-8

13 Gene Product Result for
Species: Human KRTAP19-8(728299)
UniProtKB ID: Q3LI54
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099219 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125771 MISSION® esiRNA esiRNA human KRTAP19-8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099219 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320209 predicted 254
2 SASI_Hs02_00320210 predicted 226
3 SASI_Hs02_00320211 predicted 255
4 SASI_Hs02_00320212 predicted 170
5 SASI_Hs02_00320213 predicted 226
6 SASI_Hs02_00320214 predicted 223
7 SASI_Hs02_00320215 predicted 176
8 SASI_Hs02_00320216 predicted 150
9 SASI_Hs02_00320217 predicted 174
10 SASI_Hs02_00320218 predicted 178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099219
KRTAP19-8 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 19-8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-100s21c1
Sequence:CCGGTATGGCTATGGCTGCGGCTATCTCGAGATAGCCGCAGCCATAGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-118s21c1
Sequence:CCGGTATGGCAGCTTCCGCAGGTTGCTCGAGCAACCTGCGGAAGCTGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-53s21c1
Sequence:CCGGATTATGGAGGCCTGGGCTATGCTCGAGCATAGCCCAGGCCTCCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-37s21c1
Sequence:CCGGAGCTACTACAGAAGCTATTATCTCGAGATAATAGCTTCTGTAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-68s21c1
Sequence:CCGGGCTATGGCTATGGAGGCTTTGCTCGAGCAAAGCCTCCATAGCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099219
KRTAP19-8 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 19-8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-100s21c1
Sequence:CCGGTATGGCTATGGCTGCGGCTATCTCGAGATAGCCGCAGCCATAGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-118s21c1
Sequence:CCGGTATGGCAGCTTCCGCAGGTTGCTCGAGCAACCTGCGGAAGCTGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-53s21c1
Sequence:CCGGATTATGGAGGCCTGGGCTATGCTCGAGCATAGCCCAGGCCTCCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-37s21c1
Sequence:CCGGAGCTACTACAGAAGCTATTATCTCGAGATAATAGCTTCTGTAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-68s21c1
Sequence:CCGGGCTATGGCTATGGAGGCTTTGCTCGAGCAAAGCCTCCATAGCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099219
KRTAP19-8 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 19-8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-100s21c1
Sequence:CCGGTATGGCTATGGCTGCGGCTATCTCGAGATAGCCGCAGCCATAGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-118s21c1
Sequence:CCGGTATGGCAGCTTCCGCAGGTTGCTCGAGCAACCTGCGGAAGCTGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-53s21c1
Sequence:CCGGATTATGGAGGCCTGGGCTATGCTCGAGCATAGCCCAGGCCTCCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-37s21c1
Sequence:CCGGAGCTACTACAGAAGCTATTATCTCGAGATAATAGCTTCTGTAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099219.1-68s21c1
Sequence:CCGGGCTATGGCTATGGAGGCTTTGCTCGAGCAAAGCCTCCATAGCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)