EMAIL THIS PAGE TO A FRIEND

KRTAP2-1

keratin associated protein 2-1

42 Gene Product Result for
Synonyms: KAP2.1A KRTAP2.1A
Species: Human KRTAP2-1(81872)
UniProtKB ID: Q9BYU5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123387 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123387 Rosetta Predictions human pricing
XM_926554 Rosetta Predictions human pricing
XM_927943 Rosetta Predictions human pricing
XM_932450 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327896 predicted 545
2 SASI_Hs02_00327897 predicted 440
3 SASI_Hs02_00327898 predicted 533
4 SASI_Hs02_00327899 predicted 548
5 SASI_Hs02_00327900 predicted 539
6 SASI_Hs02_00327901 predicted 532
7 SASI_Hs02_00327902 predicted 535
8 SASI_Hs02_00327903 predicted 542
9 SASI_Hs02_00327904 predicted 505
10 SASI_Hs02_00327905 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274482 predicted 454
2 SASI_Hs01_00274483 predicted 352
3 SASI_Hs01_00274484 predicted 446
4 SASI_Hs01_00274485 predicted 239
5 SASI_Hs01_00274486 predicted 425
6 SASI_Hs01_00274487 predicted 679
7 SASI_Hs01_00274488 predicted 654
8 SASI_Hs01_00274489 predicted 543
9 SASI_Hs01_00274490 predicted 665
10 SASI_Hs01_00274491 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266618 predicted 350
2 SASI_Hs01_00266619 predicted 351
3 SASI_Hs01_00266620 predicted 428
4 SASI_Hs01_00266621 predicted 462
5 SASI_Hs01_00266622 predicted 455
6 SASI_Hs01_00266623 predicted 348
7 SASI_Hs01_00266624 predicted 450
8 SASI_Hs01_00266625 predicted 239
9 SASI_Hs01_00266626 predicted 545
10 SASI_Hs01_00266627 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290098 predicted 355
2 SASI_Hs01_00290099 predicted 353
3 SASI_Hs01_00290100 predicted 344
4 SASI_Hs01_00290101 predicted 237
5 SASI_Hs01_00290102 predicted 551
6 SASI_Hs01_00290103 predicted 605
7 SASI_Hs01_00290104 predicted 658
8 SASI_Hs01_00290105 predicted 490
9 SASI_Hs01_00290106 predicted 538
10 SASI_Hs01_00290107 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123387
KRTAP2-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 2-1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-589s21c1
Sequence:CCGGCTACTTTAACAAACCTCCTGCCTCGAGGCAGGAGGTTTGTTAAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-603s21c1
Sequence:CCGGCTCCTGCCCTGAGCCCACAAACTCGAGTTTGTGGGCTCAGGGCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-518s21c1
Sequence:CCGGTCCTGCTGAGCAGTGCACTGACTCGAGTCAGTGCACTGCTCAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-578s21c1
Sequence:CCGGCTCCCATTTCTCTACTTTAACCTCGAGGTTAAAGTAGAGAAATGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123387
KRTAP2-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 2-1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-589s21c1
Sequence:CCGGCTACTTTAACAAACCTCCTGCCTCGAGGCAGGAGGTTTGTTAAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-603s21c1
Sequence:CCGGCTCCTGCCCTGAGCCCACAAACTCGAGTTTGTGGGCTCAGGGCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-518s21c1
Sequence:CCGGTCCTGCTGAGCAGTGCACTGACTCGAGTCAGTGCACTGCTCAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-578s21c1
Sequence:CCGGCTCCCATTTCTCTACTTTAACCTCGAGGTTAAAGTAGAGAAATGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123387
KRTAP2-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 2-1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-589s21c1
Sequence:CCGGCTACTTTAACAAACCTCCTGCCTCGAGGCAGGAGGTTTGTTAAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-603s21c1
Sequence:CCGGCTCCTGCCCTGAGCCCACAAACTCGAGTTTGTGGGCTCAGGGCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-518s21c1
Sequence:CCGGTCCTGCTGAGCAGTGCACTGACTCGAGTCAGTGCACTGCTCAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123387.1-578s21c1
Sequence:CCGGCTCCCATTTCTCTACTTTAACCTCGAGGTTAAAGTAGAGAAATGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)