EMAIL THIS PAGE TO A FRIEND

KRTAP20-2

keratin associated protein 20-2

23 Gene Product Result for
Synonyms: KAP20.2
UniProtKB ID: Q3LI61
Gene ID:
Mouse(622935) keratin associated protein 20-2
Rat(100359560) keratin associated protein 20-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101571 MISSION® esiRNA esiRNA human KRTAP20-2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181616 Rosetta Predictions human pricing
XM_897414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121176 predicted 123
2 SASI_Hs01_00121177 predicted 120
3 SASI_Hs01_00121178 predicted 111
4 SASI_Hs01_00121179 predicted 23
5 SASI_Hs01_00121180 predicted 72
6 SASI_Hs01_00121181 predicted 17
7 SASI_Hs01_00121182 predicted 9
8 SASI_Hs01_00121183 predicted 42
9 SASI_Hs01_00121184 predicted 45
10 SASI_Hs01_00121185 predicted 119
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00429855 predicted 132
2 SASI_Mm02_00429856 predicted 134
3 SASI_Mm02_00429857 predicted 130
4 SASI_Mm02_00429858 predicted 130
5 SASI_Mm02_00429859 predicted 153
6 SASI_Mm02_00429860 predicted 153
7 SASI_Mm02_00429861 predicted 144
8 SASI_Mm02_00429862 predicted 132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163615
KRTAP20-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 20-2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-294s21c1
Sequence:CCGGTATAAGCTTCTTCACATCAAGCTCGAGCTTGATGTGAAGAAGCTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-278s21c1
Sequence:CCGGGTCTTAATGAAGTGCTTATAACTCGAGTTATAAGCACTTCATTAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-305s21c1
Sequence:CCGGTCACATCAAGAACTCTTAAATCTCGAGATTTAAGAGTTCTTGATGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-252s21c1
Sequence:CCGGGCCCAGAATGTTGCCTATAAACTCGAGTTTATAGGCAACATTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-264s21c1
Sequence:CCGGGCCTATAAACTGCTGTCTTAACTCGAGTTAAGACAGCAGTTTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163615
KRTAP20-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 20-2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-294s21c1
Sequence:CCGGTATAAGCTTCTTCACATCAAGCTCGAGCTTGATGTGAAGAAGCTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-278s21c1
Sequence:CCGGGTCTTAATGAAGTGCTTATAACTCGAGTTATAAGCACTTCATTAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-305s21c1
Sequence:CCGGTCACATCAAGAACTCTTAAATCTCGAGATTTAAGAGTTCTTGATGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-252s21c1
Sequence:CCGGGCCCAGAATGTTGCCTATAAACTCGAGTTTATAGGCAACATTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-264s21c1
Sequence:CCGGGCCTATAAACTGCTGTCTTAACTCGAGTTAAGACAGCAGTTTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163615
KRTAP20-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 20-2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-294s21c1
Sequence:CCGGTATAAGCTTCTTCACATCAAGCTCGAGCTTGATGTGAAGAAGCTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-278s21c1
Sequence:CCGGGTCTTAATGAAGTGCTTATAACTCGAGTTATAAGCACTTCATTAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-305s21c1
Sequence:CCGGTCACATCAAGAACTCTTAAATCTCGAGATTTAAGAGTTCTTGATGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-252s21c1
Sequence:CCGGGCCCAGAATGTTGCCTATAAACTCGAGTTTATAGGCAACATTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163615.1-264s21c1
Sequence:CCGGGCCTATAAACTGCTGTCTTAACTCGAGTTAAGACAGCAGTTTATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)