EMAIL THIS PAGE TO A FRIEND

KRTAP20-3

keratin associated protein 20-3

15 Gene Product Result for
Synonyms: KAP19D KAP20.3 KRTAP19P4
Species: Human KRTAP20-3(337985)
UniProtKB ID: Q3LI60
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128077 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128077 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330496 predicted 201
2 SASI_Hs02_00330497 predicted 159
3 SASI_Hs02_00330498 predicted 54
4 SASI_Hs02_00330499 predicted 62
5 SASI_Hs02_00330500 predicted 166
6 SASI_Hs02_00330501 predicted 55
7 SASI_Hs02_00330502 predicted 197
8 SASI_Hs02_00330503 predicted 180
9 SASI_Hs02_00330504 predicted 57
10 SASI_Hs02_00330505 predicted 169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128077
KRTAP20-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 20-3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-82s21c1
Sequence:CCGGTAGTTATACCTCTGGCTTTGGCTCGAGCCAAAGCCAGAGGTATAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-35s21c1
Sequence:CCGGTATGGCAACTACTACGGAGGACTCGAGTCCTCCGTAGTAGTTGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-59s21c1
Sequence:CCGGGGCTATGGCTATGACTGTAAACTCGAGTTTACAGTCATAGCCATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-71s21c1
Sequence:CCGGGACTGTAAATATAGTTATACCCTCGAGGGTATAACTATATTTACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-94s21c1
Sequence:CCGGTGGCTTTGGTGCCTTTAGAATCTCGAGATTCTAAAGGCACCAAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128077
KRTAP20-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 20-3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-82s21c1
Sequence:CCGGTAGTTATACCTCTGGCTTTGGCTCGAGCCAAAGCCAGAGGTATAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-35s21c1
Sequence:CCGGTATGGCAACTACTACGGAGGACTCGAGTCCTCCGTAGTAGTTGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-59s21c1
Sequence:CCGGGGCTATGGCTATGACTGTAAACTCGAGTTTACAGTCATAGCCATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-71s21c1
Sequence:CCGGGACTGTAAATATAGTTATACCCTCGAGGGTATAACTATATTTACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-94s21c1
Sequence:CCGGTGGCTTTGGTGCCTTTAGAATCTCGAGATTCTAAAGGCACCAAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128077
KRTAP20-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 20-3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-82s21c1
Sequence:CCGGTAGTTATACCTCTGGCTTTGGCTCGAGCCAAAGCCAGAGGTATAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-35s21c1
Sequence:CCGGTATGGCAACTACTACGGAGGACTCGAGTCCTCCGTAGTAGTTGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-59s21c1
Sequence:CCGGGGCTATGGCTATGACTGTAAACTCGAGTTTACAGTCATAGCCATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-71s21c1
Sequence:CCGGGACTGTAAATATAGTTATACCCTCGAGGGTATAACTATATTTACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128077.1-94s21c1
Sequence:CCGGTGGCTTTGGTGCCTTTAGAATCTCGAGATTCTAAAGGCACCAAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)