EMAIL THIS PAGE TO A FRIEND

KRTAP21-1

keratin associated protein 21-1

21 Gene Product Result for
Synonyms: KAP21.1
UniProtKB ID: Q3LI58
Gene ID:
Mouse(170656) keratin associated protein 21-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_028621 Rosetta Predictions mouse pricing
NM_130875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023347 predicted 478
2 SASI_Mm01_00023348 predicted 505
3 SASI_Mm01_00023349 predicted 487
4 SASI_Mm02_00334113 predicted 474
5 SASI_Mm01_00023350 predicted 435
6 SASI_Mm01_00023351 predicted 461
7 SASI_Mm01_00023352 predicted 400
8 SASI_Mm01_00023353 predicted 436
9 SASI_Mm01_00023354 predicted 455
10 SASI_Mm01_00023355 predicted 410
11 SASI_Mm01_00023356 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074030 predicted 56
2 SASI_Mm01_00074031 predicted 58
3 SASI_Mm01_00074032 predicted 40
4 SASI_Mm01_00074033 predicted 332
5 SASI_Mm01_00074034 predicted 23
6 SASI_Mm01_00074035 predicted 27
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181619
KRTAP21-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 21-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-212s21c1
Sequence:CCGGGCTTTAGAAGATGCTATTCTTCTCGAGAAGAATAGCATCTTCTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-83s21c1
Sequence:CCGGGTGGCTATGGAACTGGCTATGCTCGAGCATAGCCAGTTCCATAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-190s21c1
Sequence:CCGGTACTGTGGCTACCGGCCATTTCTCGAGAAATGGCCGGTAGCCACAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-118s21c1
Sequence:CCGGTGTGGGTTTGGCTCCCATTATCTCGAGATAATGGGAGCCAAACCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-154s21c1
Sequence:CCGGACTGGCTATGGCTGTGGATATCTCGAGATATCCACAGCCATAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181619
KRTAP21-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 21-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-212s21c1
Sequence:CCGGGCTTTAGAAGATGCTATTCTTCTCGAGAAGAATAGCATCTTCTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-83s21c1
Sequence:CCGGGTGGCTATGGAACTGGCTATGCTCGAGCATAGCCAGTTCCATAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-190s21c1
Sequence:CCGGTACTGTGGCTACCGGCCATTTCTCGAGAAATGGCCGGTAGCCACAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-118s21c1
Sequence:CCGGTGTGGGTTTGGCTCCCATTATCTCGAGATAATGGGAGCCAAACCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-154s21c1
Sequence:CCGGACTGGCTATGGCTGTGGATATCTCGAGATATCCACAGCCATAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181619
KRTAP21-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 21-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-212s21c1
Sequence:CCGGGCTTTAGAAGATGCTATTCTTCTCGAGAAGAATAGCATCTTCTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-83s21c1
Sequence:CCGGGTGGCTATGGAACTGGCTATGCTCGAGCATAGCCAGTTCCATAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-190s21c1
Sequence:CCGGTACTGTGGCTACCGGCCATTTCTCGAGAAATGGCCGGTAGCCACAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-118s21c1
Sequence:CCGGTGTGGGTTTGGCTCCCATTATCTCGAGATAATGGGAGCCAAACCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181619.1-154s21c1
Sequence:CCGGACTGGCTATGGCTGTGGATATCTCGAGATATCCACAGCCATAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028621
KRTAP21-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 21-1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-473s1c1
Sequence:CCGGGCAGTGGAAGAGCAAGTTGAACTCGAGTTCAACTTGCTCTTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-584s1c1
Sequence:CCGGCCTGAGATAAACTACTGAGTTCTCGAGAACTCAGTAGTTTATCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028621.1-100s1c1
Sequence:CCGGGCTCAAGATATGGCTATGGCTCTCGAGAGCCATAGCCATATCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-595s1c1
Sequence:CCGGCTACTGAGTTTGGTTCATCATCTCGAGATGATGAACCAAACTCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028621
KRTAP21-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 21-1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-473s1c1
Sequence:CCGGGCAGTGGAAGAGCAAGTTGAACTCGAGTTCAACTTGCTCTTCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-584s1c1
Sequence:CCGGCCTGAGATAAACTACTGAGTTCTCGAGAACTCAGTAGTTTATCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028621.1-100s1c1
Sequence:CCGGGCTCAAGATATGGCTATGGCTCTCGAGAGCCATAGCCATATCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-595s1c1
Sequence:CCGGCTACTGAGTTTGGTTCATCATCTCGAGATGATGAACCAAACTCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028621
KRTAP21-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 21-1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-473s1c1
Sequence:CCGGGCAGTGGAAGAGCAAGTTGAACTCGAGTTCAACTTGCTCTTCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-584s1c1
Sequence:CCGGCCTGAGATAAACTACTGAGTTCTCGAGAACTCAGTAGTTTATCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028621.1-100s1c1
Sequence:CCGGGCTCAAGATATGGCTATGGCTCTCGAGAGCCATAGCCATATCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028621.1-595s1c1
Sequence:CCGGCTACTGAGTTTGGTTCATCATCTCGAGATGATGAACCAAACTCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)