EMAIL THIS PAGE TO A FRIEND

KRTAP21-2

keratin associated protein 21-2

17 Gene Product Result for
Synonyms: KAP21.2
UniProtKB ID: Q3LI59
Gene ID:
Rat(685485) keratin associated protein 21-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181617 Rosetta Predictions human pricing
XM_001063981 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025089 predicted 205
2 SASI_Hs01_00025090 predicted 190
3 SASI_Hs01_00025091 predicted 219
4 SASI_Hs01_00025092 predicted 208
5 SASI_Hs01_00025093 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308943 predicted 352
2 SASI_Rn02_00308944 predicted 351
3 SASI_Rn02_00308945 predicted 18
4 SASI_Rn02_00308946 predicted 75
5 SASI_Rn02_00308947 predicted 90
6 SASI_Rn02_00308948 predicted 355
7 SASI_Rn02_00308949 predicted 95
8 SASI_Rn02_00308950 predicted 80
9 SASI_Rn02_00308951 predicted 81
10 SASI_Rn02_00308952 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181617
KRTAP21-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 21-2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-157s21c1
Sequence:CCGGTACGGCTCTGGCTGTGGATATCTCGAGATATCCACAGCCAGAGCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-97s21c1
Sequence:CCGGTACGGCTCTGGCTGTAGATATCTCGAGATATCTACAGCCAGAGCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-55s21c1
Sequence:CCGGTGGAGTTCCGGCTGTGGATATCTCGAGATATCCACAGCCGGAACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-232s21c1
Sequence:CCGGTGCTATTCCTCTTGCTACTAACTCGAGTTAGTAGCAAGAGGAATAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-207s21c1
Sequence:CCGGCTACCGACCACTTTGCTACAGCTCGAGCTGTAGCAAAGTGGTCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181617
KRTAP21-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 21-2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-157s21c1
Sequence:CCGGTACGGCTCTGGCTGTGGATATCTCGAGATATCCACAGCCAGAGCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-97s21c1
Sequence:CCGGTACGGCTCTGGCTGTAGATATCTCGAGATATCTACAGCCAGAGCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-55s21c1
Sequence:CCGGTGGAGTTCCGGCTGTGGATATCTCGAGATATCCACAGCCGGAACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-232s21c1
Sequence:CCGGTGCTATTCCTCTTGCTACTAACTCGAGTTAGTAGCAAGAGGAATAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-207s21c1
Sequence:CCGGCTACCGACCACTTTGCTACAGCTCGAGCTGTAGCAAAGTGGTCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181617
KRTAP21-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 21-2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-157s21c1
Sequence:CCGGTACGGCTCTGGCTGTGGATATCTCGAGATATCCACAGCCAGAGCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-97s21c1
Sequence:CCGGTACGGCTCTGGCTGTAGATATCTCGAGATATCTACAGCCAGAGCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-55s21c1
Sequence:CCGGTGGAGTTCCGGCTGTGGATATCTCGAGATATCCACAGCCGGAACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-232s21c1
Sequence:CCGGTGCTATTCCTCTTGCTACTAACTCGAGTTAGTAGCAAGAGGAATAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181617.1-207s21c1
Sequence:CCGGCTACCGACCACTTTGCTACAGCTCGAGCTGTAGCAAAGTGGTCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)