EMAIL THIS PAGE TO A FRIEND

KRTAP26-1

keratin associated protein 26-1

61 Gene Product Result for
UniProtKB ID: Q6PEX3, B0RZD3
Gene ID:
Mouse(69533) keratin associated protein 26-1
Rat(684589) keratin associated protein 26-1
cow(528816) keratin associated protein 26-1
dog(100686040) keratin associated protein 26-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203405 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021431 MISSION® esiRNA esiRNA human KRTAP26-1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203405 Rosetta Predictions human pricing
XM_001071151 Rosetta Predictions rat pricing
NM_027105 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244644 predicted 463
2 SASI_Hs01_00244645 predicted 458
3 SASI_Hs01_00244646 predicted 758
4 SASI_Hs01_00244647 predicted 559
5 SASI_Hs01_00244648 predicted 624
6 SASI_Hs01_00244649 predicted 581
7 SASI_Hs01_00244650 predicted 475
8 SASI_Hs01_00244651 predicted 357
9 SASI_Hs02_00373334 predicted 485
10 SASI_Hs02_00373335 predicted 424
11 SASI_Hs01_00244652 predicted 666
12 SASI_Hs01_00244653 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334024 predicted 333
2 SASI_Rn02_00334025 predicted 504
3 SASI_Rn02_00334026 predicted 338
4 SASI_Rn02_00334027 predicted 269
5 SASI_Rn02_00334028 predicted 430
6 SASI_Rn02_00334029 predicted 367
7 SASI_Rn02_00334030 predicted 371
8 SASI_Rn02_00334031 predicted 516
9 SASI_Rn02_00334032 predicted 513
10 SASI_Rn02_00334033 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191242 predicted 577
2 SASI_Mm01_00191243 predicted 409
3 SASI_Mm01_00191244 predicted 402
4 SASI_Mm01_00191245 predicted 441
5 SASI_Mm01_00191246 predicted 285
6 SASI_Mm01_00191247 predicted 536
7 SASI_Mm01_00191248 predicted 280
8 SASI_Mm01_00191249 predicted 307
9 SASI_Mm01_00191250 predicted 415
10 SASI_Mm01_00191251 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027105
KRTAP26-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 26-1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027105.2-778s21c1
Sequence:CCGGCTTCTTTCTGAGTAGCGATTACTCGAGTAATCGCTACTCAGAAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-410s21c1
Sequence:CCGGCAGGCCTGTGAGCTATGTATCCTCGAGGATACATAGCTCACAGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-309s21c1
Sequence:CCGGTCTTGTTGCTCTTCGACATACCTCGAGGTATGTCGAAGAGCAACAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027105.1-779s1c1
Sequence:CCGGGCTTCTTTCTGAGTAGCGATTCTCGAGAATCGCTACTCAGAAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-345s21c1
Sequence:CCGGTGCCAAGGATCTGGCTATATTCTCGAGAATATAGCCAGATCCTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-153s21c1
Sequence:CCGGATTGCCCTCTGCTCTACAAACCTCGAGGTTTGTAGAGCAGAGGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027105
KRTAP26-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 26-1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027105.2-778s21c1
Sequence:CCGGCTTCTTTCTGAGTAGCGATTACTCGAGTAATCGCTACTCAGAAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-410s21c1
Sequence:CCGGCAGGCCTGTGAGCTATGTATCCTCGAGGATACATAGCTCACAGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-309s21c1
Sequence:CCGGTCTTGTTGCTCTTCGACATACCTCGAGGTATGTCGAAGAGCAACAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027105.1-779s1c1
Sequence:CCGGGCTTCTTTCTGAGTAGCGATTCTCGAGAATCGCTACTCAGAAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-345s21c1
Sequence:CCGGTGCCAAGGATCTGGCTATATTCTCGAGAATATAGCCAGATCCTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-153s21c1
Sequence:CCGGATTGCCCTCTGCTCTACAAACCTCGAGGTTTGTAGAGCAGAGGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027105
KRTAP26-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 26-1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027105.2-778s21c1
Sequence:CCGGCTTCTTTCTGAGTAGCGATTACTCGAGTAATCGCTACTCAGAAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-410s21c1
Sequence:CCGGCAGGCCTGTGAGCTATGTATCCTCGAGGATACATAGCTCACAGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-309s21c1
Sequence:CCGGTCTTGTTGCTCTTCGACATACCTCGAGGTATGTCGAAGAGCAACAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027105.1-779s1c1
Sequence:CCGGGCTTCTTTCTGAGTAGCGATTCTCGAGAATCGCTACTCAGAAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-345s21c1
Sequence:CCGGTGCCAAGGATCTGGCTATATTCTCGAGAATATAGCCAGATCCTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027105.2-153s21c1
Sequence:CCGGATTGCCCTCTGCTCTACAAACCTCGAGGTTTGTAGAGCAGAGGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203405
KRTAP26-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 26-1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-1006s1c1
Sequence:CCGGCCTGATCTAATGCAAGCTGCTCTCGAGAGCAGCTTGCATTAGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-286s1c1
Sequence:CCGGCCAACTCAGGATCTCTCAGAACTCGAGTTCTGAGAGATCCTGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-314s1c1
Sequence:CCGGCCATATTCCTCTCACCTCCATCTCGAGATGGAGGTGAGAGGAATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-893s1c1
Sequence:CCGGGCAGCTTCTTTGTTCCAGTGACTCGAGTCACTGGAACAAAGAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-896s1c1
Sequence:CCGGGCTTCTTTGTTCCAGTGAATACTCGAGTATTCACTGGAACAAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-768s1c1
Sequence:CCGGCGTCCTCAAAGTCTTCACGTTCTCGAGAACGTGAAGACTTTGAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-580s1c1
Sequence:CCGGCAGTATCCTGTAGACCACAGACTCGAGTCTGTGGTCTACAGGATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203405
KRTAP26-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 26-1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-1006s1c1
Sequence:CCGGCCTGATCTAATGCAAGCTGCTCTCGAGAGCAGCTTGCATTAGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-286s1c1
Sequence:CCGGCCAACTCAGGATCTCTCAGAACTCGAGTTCTGAGAGATCCTGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-314s1c1
Sequence:CCGGCCATATTCCTCTCACCTCCATCTCGAGATGGAGGTGAGAGGAATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-893s1c1
Sequence:CCGGGCAGCTTCTTTGTTCCAGTGACTCGAGTCACTGGAACAAAGAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-896s1c1
Sequence:CCGGGCTTCTTTGTTCCAGTGAATACTCGAGTATTCACTGGAACAAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-768s1c1
Sequence:CCGGCGTCCTCAAAGTCTTCACGTTCTCGAGAACGTGAAGACTTTGAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-580s1c1
Sequence:CCGGCAGTATCCTGTAGACCACAGACTCGAGTCTGTGGTCTACAGGATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203405
KRTAP26-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 26-1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-1006s1c1
Sequence:CCGGCCTGATCTAATGCAAGCTGCTCTCGAGAGCAGCTTGCATTAGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-286s1c1
Sequence:CCGGCCAACTCAGGATCTCTCAGAACTCGAGTTCTGAGAGATCCTGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-314s1c1
Sequence:CCGGCCATATTCCTCTCACCTCCATCTCGAGATGGAGGTGAGAGGAATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-893s1c1
Sequence:CCGGGCAGCTTCTTTGTTCCAGTGACTCGAGTCACTGGAACAAAGAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203405.1-896s1c1
Sequence:CCGGGCTTCTTTGTTCCAGTGAATACTCGAGTATTCACTGGAACAAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-768s1c1
Sequence:CCGGCGTCCTCAAAGTCTTCACGTTCTCGAGAACGTGAAGACTTTGAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203405.1-580s1c1
Sequence:CCGGCAGTATCCTGTAGACCACAGACTCGAGTCTGTGGTCTACAGGATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)