EMAIL THIS PAGE TO A FRIEND

KRTAP27-1

keratin associated protein 27-1

30 Gene Product Result for
UniProtKB ID: Q3LI81
Gene ID:
Mouse(239933) keratin associated protein 27-1
Rat(100364613) keratin associated protein 27-1
dog(487723) keratin associated protein 27-1
cow(100141020) keratin associated protein 27-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001077711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077711 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077711 Rosetta Predictions human pricing
XM_927093 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313246 predicted 444
2 SASI_Hs02_00313247 predicted 227
3 SASI_Hs02_00313248 predicted 206
4 SASI_Hs02_00313249 predicted 200
5 SASI_Hs02_00313250 predicted 208
6 SASI_Hs02_00313251 predicted 229
7 SASI_Hs02_00313252 predicted 197
8 SASI_Hs02_00313253 predicted 240
9 SASI_Hs02_00313254 predicted 433
10 SASI_Hs02_00313255 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285341 predicted 206
2 SASI_Hs01_00285342 predicted 244
3 SASI_Hs01_00285343 predicted 395
4 SASI_Hs01_00285344 predicted 215
5 SASI_Hs01_00285345 predicted 301
6 SASI_Hs01_00285346 predicted 212
7 SASI_Hs01_00285347 predicted 384
8 SASI_Hs01_00285348 predicted 291
9 SASI_Hs01_00285349 predicted 260
10 SASI_Hs01_00285350 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163105
KRTAP27-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 27-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-403s21c1
Sequence:CCGGGCCAAGTGTTGCCCACTAAAGCTCGAGCTTTAGTGGGCAACACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-64s21c1
Sequence:CCGGACACACAACTCTAATCCTAAACTCGAGTTTAGGATTAGAGTTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-335s21c1
Sequence:CCGGCCTGCCAATCAAGGAATTATACTCGAGTATAATTCCTTGATTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-174s21c1
Sequence:CCGGTACCTGCCAACCAGCCAATTGCTCGAGCAATTGGCTGGTTGGCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-379s21c1
Sequence:CCGGAGCTACCAACCTGCAAGTTACCTCGAGGTAACTTGCAGGTTGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163105
KRTAP27-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 27-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-403s21c1
Sequence:CCGGGCCAAGTGTTGCCCACTAAAGCTCGAGCTTTAGTGGGCAACACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-64s21c1
Sequence:CCGGACACACAACTCTAATCCTAAACTCGAGTTTAGGATTAGAGTTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-335s21c1
Sequence:CCGGCCTGCCAATCAAGGAATTATACTCGAGTATAATTCCTTGATTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-174s21c1
Sequence:CCGGTACCTGCCAACCAGCCAATTGCTCGAGCAATTGGCTGGTTGGCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-379s21c1
Sequence:CCGGAGCTACCAACCTGCAAGTTACCTCGAGGTAACTTGCAGGTTGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163105
KRTAP27-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 27-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-403s21c1
Sequence:CCGGGCCAAGTGTTGCCCACTAAAGCTCGAGCTTTAGTGGGCAACACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-64s21c1
Sequence:CCGGACACACAACTCTAATCCTAAACTCGAGTTTAGGATTAGAGTTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-335s21c1
Sequence:CCGGCCTGCCAATCAAGGAATTATACTCGAGTATAATTCCTTGATTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-174s21c1
Sequence:CCGGTACCTGCCAACCAGCCAATTGCTCGAGCAATTGGCTGGTTGGCAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163105.1-379s21c1
Sequence:CCGGAGCTACCAACCTGCAAGTTACCTCGAGGTAACTTGCAGGTTGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077711
KRTAP27-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 27-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-92s21c1
Sequence:CCGGACATGGCACTAATCCTATAACCTCGAGGTTATAGGATTAGTGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-273s21c1
Sequence:CCGGGGAGTTGTCCAAACTACTTACCTCGAGGTAAGTAGTTTGGACAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-144s21c1
Sequence:CCGGTTCCATAGCAGAACCTGTTTCCTCGAGGAAACAGGTTCTGCTATGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-243s21c1
Sequence:CCGGGATAGCTGTGTGCAAAGTAACCTCGAGGTTACTTTGCACACAGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-215s21c1
Sequence:CCGGCAATTGTGAACAGGACTTATTCTCGAGAATAAGTCCTGTTCACAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077711
KRTAP27-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 27-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-92s21c1
Sequence:CCGGACATGGCACTAATCCTATAACCTCGAGGTTATAGGATTAGTGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-273s21c1
Sequence:CCGGGGAGTTGTCCAAACTACTTACCTCGAGGTAAGTAGTTTGGACAACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-144s21c1
Sequence:CCGGTTCCATAGCAGAACCTGTTTCCTCGAGGAAACAGGTTCTGCTATGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-243s21c1
Sequence:CCGGGATAGCTGTGTGCAAAGTAACCTCGAGGTTACTTTGCACACAGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-215s21c1
Sequence:CCGGCAATTGTGAACAGGACTTATTCTCGAGAATAAGTCCTGTTCACAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077711
KRTAP27-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 27-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-92s21c1
Sequence:CCGGACATGGCACTAATCCTATAACCTCGAGGTTATAGGATTAGTGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-273s21c1
Sequence:CCGGGGAGTTGTCCAAACTACTTACCTCGAGGTAAGTAGTTTGGACAACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-144s21c1
Sequence:CCGGTTCCATAGCAGAACCTGTTTCCTCGAGGAAACAGGTTCTGCTATGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-243s21c1
Sequence:CCGGGATAGCTGTGTGCAAAGTAACCTCGAGGTTACTTTGCACACAGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077711.1-215s21c1
Sequence:CCGGCAATTGTGAACAGGACTTATTCTCGAGAATAAGTCCTGTTCACAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)