EMAIL THIS PAGE TO A FRIEND

KRTAP3-1

keratin associated protein 3-1

70 Gene Product Result for
Synonyms: KAP3.1 KRTAP3.1
UniProtKB ID: Q9BYR8, Q14DM4
Gene ID:
Human(83896) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(69473) keratin associated protein 3-1
Rat(680071) keratin associated protein 3-1
Goat(100861180) keratin associated protein 3-1
cow(768046) keratin associated protein 3-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031958 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU198691 MISSION® esiRNA esiRNA targeting mouse Krtap3-1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031958 Rosetta Predictions human pricing
XM_001055567 Rosetta Predictions rat pricing
XM_001472357 Rosetta Predictions mouse pricing
XM_894811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065614 predicted 203
2 SASI_Hs01_00065615 predicted 252
3 SASI_Hs01_00065616 predicted 254
4 SASI_Hs01_00065617 predicted 324
5 SASI_Hs01_00065618 predicted 257
6 SASI_Hs01_00065619 predicted 199
7 SASI_Hs01_00065620 predicted 259
8 SASI_Hs01_00065621 predicted 267
9 SASI_Hs02_00359134 predicted 210
10 SASI_Hs01_00065622 predicted 269
11 SASI_Hs01_00065623 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280059 predicted 205
2 SASI_Rn02_00280060 predicted 313
3 SASI_Rn02_00280061 predicted 263
4 SASI_Rn02_00280062 predicted 277
5 SASI_Rn02_00280063 predicted 277
6 SASI_Rn02_00280064 predicted 152
7 SASI_Rn02_00280065 predicted 228
8 SASI_Rn02_00280066 predicted 324
9 SASI_Rn02_00280067 predicted 326
10 SASI_Rn02_00280068 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00360975 predicted 332
2 SASI_Mm02_00360976 predicted 261
3 SASI_Mm02_00360977 predicted 269
4 SASI_Mm02_00360978 predicted 328
5 SASI_Mm02_00360979 predicted 280
6 SASI_Mm02_00360980 predicted 204
7 SASI_Mm02_00360981 predicted 354
8 SASI_Mm02_00360982 predicted 236
9 SASI_Mm02_00360983 predicted 260
10 SASI_Mm02_00360984 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263974 predicted 333
2 SASI_Mm01_00263975 predicted 270
3 SASI_Mm01_00263976 predicted 265
4 SASI_Mm01_00263978 predicted 325
5 SASI_Mm01_00263979 predicted 277
6 SASI_Mm01_00263980 predicted 211
7 SASI_Mm01_00263981 predicted 356
8 SASI_Mm02_00429559 predicted 231
9 SASI_Mm01_00263982 predicted 254
10 SASI_Mm02_00429560 predicted 217
11 SASI_Mm01_00263977 predicted 217
12 SASI_Mm01_00263983 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031958
VALIDATED
KRTAP3-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 3-1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031958.1-332s21c1
Sequence:CCGGTGTTAACCAGCCGAGTCTGCACTCGAGTGCAGACTCGGCTGGTTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-403s21c1
Sequence:CCGGGCACTCACTACTGCCTACATCCTCGAGGATGTAGGCAGTAGTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031958.1-414s21c1
Sequence:CCGGTGCCTACATCAAGGCTAAGGCCTCGAGGCCTTAGCCTTGATGTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-425s21c1
Sequence:CCGGAGGCTAAGGCCATCCCAATCCCTCGAGGGATTGGGATGGCCTTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-90s1c1
Sequence:CCGGCCACCTTCTGCTCATTTGATACTCGAGTATCAAATGAGCAGAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-280s1c1
Sequence:CCGGCAACCTGACCACCTATGTTCACTCGAGTGAACATAGGTGGTCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-91s1c1
Sequence:CCGGCACCTTCTGCTCATTTGATAACTCGAGTTATCAAATGAGCAGAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-374s21c1
Sequence:CCGGCCAATGTCCTCTGCACCATCTCTCGAGAGATGGTGCAGAGGACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031958
VALIDATED
KRTAP3-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 3-1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031958.1-332s21c1
Sequence:CCGGTGTTAACCAGCCGAGTCTGCACTCGAGTGCAGACTCGGCTGGTTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-403s21c1
Sequence:CCGGGCACTCACTACTGCCTACATCCTCGAGGATGTAGGCAGTAGTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031958.1-414s21c1
Sequence:CCGGTGCCTACATCAAGGCTAAGGCCTCGAGGCCTTAGCCTTGATGTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-425s21c1
Sequence:CCGGAGGCTAAGGCCATCCCAATCCCTCGAGGGATTGGGATGGCCTTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-90s1c1
Sequence:CCGGCCACCTTCTGCTCATTTGATACTCGAGTATCAAATGAGCAGAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-280s1c1
Sequence:CCGGCAACCTGACCACCTATGTTCACTCGAGTGAACATAGGTGGTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-91s1c1
Sequence:CCGGCACCTTCTGCTCATTTGATAACTCGAGTTATCAAATGAGCAGAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-374s21c1
Sequence:CCGGCCAATGTCCTCTGCACCATCTCTCGAGAGATGGTGCAGAGGACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031958
VALIDATED
KRTAP3-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 3-1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031958.1-332s21c1
Sequence:CCGGTGTTAACCAGCCGAGTCTGCACTCGAGTGCAGACTCGGCTGGTTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-403s21c1
Sequence:CCGGGCACTCACTACTGCCTACATCCTCGAGGATGTAGGCAGTAGTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031958.1-414s21c1
Sequence:CCGGTGCCTACATCAAGGCTAAGGCCTCGAGGCCTTAGCCTTGATGTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-425s21c1
Sequence:CCGGAGGCTAAGGCCATCCCAATCCCTCGAGGGATTGGGATGGCCTTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-90s1c1
Sequence:CCGGCCACCTTCTGCTCATTTGATACTCGAGTATCAAATGAGCAGAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-280s1c1
Sequence:CCGGCAACCTGACCACCTATGTTCACTCGAGTGAACATAGGTGGTCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031958.1-91s1c1
Sequence:CCGGCACCTTCTGCTCATTTGATAACTCGAGTTATCAAATGAGCAGAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031958.1-374s21c1
Sequence:CCGGCCAATGTCCTCTGCACCATCTCTCGAGAGATGGTGCAGAGGACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)