EMAIL THIS PAGE TO A FRIEND

KRTAP3-2

keratin associated protein 3-2

48 Gene Product Result for
Synonyms: KAP3.2 KRTAP3.2
UniProtKB ID: Q9BYR7
Gene ID:
Human(83897) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(66708) keratin associated protein 3-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031959 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031959 Rosetta Predictions human pricing
NM_025720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106887 predicted 391
2 SASI_Hs01_00106888 predicted 380
3 SASI_Hs01_00106889 predicted 343
4 SASI_Hs01_00106891 predicted 389
5 SASI_Hs01_00106894 predicted 430
6 SASI_Hs02_00359135 predicted 363
7 SASI_Hs02_00359136 predicted 347
8 SASI_Hs02_00359137 predicted 443
9 SASI_Hs02_00359138 predicted 345
10 SASI_Hs02_00359139 predicted 579
11 SASI_Hs01_00106886 predicted 324
12 SASI_Hs01_00106890 predicted 330
13 SASI_Hs01_00106892 predicted 234
14 SASI_Hs01_00106893 predicted 325
15 SASI_Hs01_00106895 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110797 predicted 410
2 SASI_Mm01_00110798 predicted 280
3 SASI_Mm01_00110799 predicted 271
4 SASI_Mm01_00110800 predicted 360
5 SASI_Mm01_00110801 predicted 359
6 SASI_Mm01_00110802 predicted 332
7 SASI_Mm01_00110803 predicted 540
8 SASI_Mm01_00110804 predicted 503
9 SASI_Mm01_00110805 predicted 364
10 SASI_Mm01_00110806 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025720
KRTAP3-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 3-2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-529s1c1
Sequence:CCGGGAATAGCCATTTGACTGATTTCTCGAGAAATCAGTCAAATGGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-556s1c1
Sequence:CCGGGTGAACATCTTCCATTATGAACTCGAGTTCATAATGGAAGATGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-864s1c1
Sequence:CCGGCCTGATTTGTTATCAGTCTTTCTCGAGAAAGACTGATAACAAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-409s21c1
Sequence:CCGGACCACCTGCTTGTCTCAATAGCTCGAGCTATTGAGACAAGCAGGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-362s21c1
Sequence:CCGGTCCCTTGCTTGACGCCTCATACTCGAGTATGAGGCGTCAAGCAAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-453s21c1
Sequence:CCGGGATGACCTAAGCCATGGAAACCTCGAGGTTTCCATGGCTTAGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-622s21c1
Sequence:CCGGATGTTGCTTCTGGGATCTCATCTCGAGATGAGATCCCAGAAGCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-553s1c1
Sequence:CCGGCAGGTGAACATCTTCCATTATCTCGAGATAATGGAAGATGTTCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025720
KRTAP3-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 3-2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-529s1c1
Sequence:CCGGGAATAGCCATTTGACTGATTTCTCGAGAAATCAGTCAAATGGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-556s1c1
Sequence:CCGGGTGAACATCTTCCATTATGAACTCGAGTTCATAATGGAAGATGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-864s1c1
Sequence:CCGGCCTGATTTGTTATCAGTCTTTCTCGAGAAAGACTGATAACAAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-409s21c1
Sequence:CCGGACCACCTGCTTGTCTCAATAGCTCGAGCTATTGAGACAAGCAGGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-362s21c1
Sequence:CCGGTCCCTTGCTTGACGCCTCATACTCGAGTATGAGGCGTCAAGCAAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-453s21c1
Sequence:CCGGGATGACCTAAGCCATGGAAACCTCGAGGTTTCCATGGCTTAGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-622s21c1
Sequence:CCGGATGTTGCTTCTGGGATCTCATCTCGAGATGAGATCCCAGAAGCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-553s1c1
Sequence:CCGGCAGGTGAACATCTTCCATTATCTCGAGATAATGGAAGATGTTCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025720
KRTAP3-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 3-2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-529s1c1
Sequence:CCGGGAATAGCCATTTGACTGATTTCTCGAGAAATCAGTCAAATGGCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-556s1c1
Sequence:CCGGGTGAACATCTTCCATTATGAACTCGAGTTCATAATGGAAGATGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-864s1c1
Sequence:CCGGCCTGATTTGTTATCAGTCTTTCTCGAGAAAGACTGATAACAAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-409s21c1
Sequence:CCGGACCACCTGCTTGTCTCAATAGCTCGAGCTATTGAGACAAGCAGGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-362s21c1
Sequence:CCGGTCCCTTGCTTGACGCCTCATACTCGAGTATGAGGCGTCAAGCAAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-453s21c1
Sequence:CCGGGATGACCTAAGCCATGGAAACCTCGAGGTTTCCATGGCTTAGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025720.3-622s21c1
Sequence:CCGGATGTTGCTTCTGGGATCTCATCTCGAGATGAGATCCCAGAAGCAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025720.1-553s1c1
Sequence:CCGGCAGGTGAACATCTTCCATTATCTCGAGATAATGGAAGATGTTCACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031959
KRTAP3-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 3-2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000139098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-370s1c1
Sequence:CCGGCAGAAGCTGTCCCTTCAGTATCTCGAGATACTGAAGGGACAGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-399s1c1
Sequence:CCGGCTCAGTAGTTTGCCAGATGTTCTCGAGAACATCTGGCAAACTACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-410s1c1
Sequence:CCGGGCCAGATGTTAAGGTAGACCACTCGAGTGGTCTACCTTAACATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-437s1c1
Sequence:CCGGCCAGATATGAAGAACTTACCTCTCGAGAGGTAAGTTCTTCATATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-385s1c1
Sequence:CCGGCAGTATTCACTTGCCTCAGTACTCGAGTACTGAGGCAAGTGAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-354s1c1
Sequence:CCGGCCGACAACGAAGAATCCAGAACTCGAGTTCTGGATTCTTCGTTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-434s1c1
Sequence:CCGGGACCCAGATATGAAGAACTTACTCGAGTAAGTTCTTCATATCTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-401s1c1
Sequence:CCGGCAGTAGTTTGCCAGATGTTAACTCGAGTTAACATCTGGCAAACTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031959.2-340s21c1
Sequence:CCGGACTTTGCTCAGTGCCCGACAACTCGAGTTGTCGGGCACTGAGCAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031959.2-576s21c1
Sequence:CCGGAGACCTCAGATTACATGTTCTCTCGAGAGAACATGTAATCTGAGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031959
KRTAP3-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 3-2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000139098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-370s1c1
Sequence:CCGGCAGAAGCTGTCCCTTCAGTATCTCGAGATACTGAAGGGACAGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-399s1c1
Sequence:CCGGCTCAGTAGTTTGCCAGATGTTCTCGAGAACATCTGGCAAACTACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-410s1c1
Sequence:CCGGGCCAGATGTTAAGGTAGACCACTCGAGTGGTCTACCTTAACATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-437s1c1
Sequence:CCGGCCAGATATGAAGAACTTACCTCTCGAGAGGTAAGTTCTTCATATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-385s1c1
Sequence:CCGGCAGTATTCACTTGCCTCAGTACTCGAGTACTGAGGCAAGTGAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-354s1c1
Sequence:CCGGCCGACAACGAAGAATCCAGAACTCGAGTTCTGGATTCTTCGTTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-434s1c1
Sequence:CCGGGACCCAGATATGAAGAACTTACTCGAGTAAGTTCTTCATATCTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-401s1c1
Sequence:CCGGCAGTAGTTTGCCAGATGTTAACTCGAGTTAACATCTGGCAAACTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031959.2-340s21c1
Sequence:CCGGACTTTGCTCAGTGCCCGACAACTCGAGTTGTCGGGCACTGAGCAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031959.2-576s21c1
Sequence:CCGGAGACCTCAGATTACATGTTCTCTCGAGAGAACATGTAATCTGAGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031959
KRTAP3-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 3-2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000139098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-370s1c1
Sequence:CCGGCAGAAGCTGTCCCTTCAGTATCTCGAGATACTGAAGGGACAGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-399s1c1
Sequence:CCGGCTCAGTAGTTTGCCAGATGTTCTCGAGAACATCTGGCAAACTACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-410s1c1
Sequence:CCGGGCCAGATGTTAAGGTAGACCACTCGAGTGGTCTACCTTAACATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-437s1c1
Sequence:CCGGCCAGATATGAAGAACTTACCTCTCGAGAGGTAAGTTCTTCATATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-385s1c1
Sequence:CCGGCAGTATTCACTTGCCTCAGTACTCGAGTACTGAGGCAAGTGAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-354s1c1
Sequence:CCGGCCGACAACGAAGAATCCAGAACTCGAGTTCTGGATTCTTCGTTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-434s1c1
Sequence:CCGGGACCCAGATATGAAGAACTTACTCGAGTAAGTTCTTCATATCTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031959.2-401s1c1
Sequence:CCGGCAGTAGTTTGCCAGATGTTAACTCGAGTTAACATCTGGCAAACTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031959.2-340s21c1
Sequence:CCGGACTTTGCTCAGTGCCCGACAACTCGAGTTGTCGGGCACTGAGCAAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031959.2-576s21c1
Sequence:CCGGAGACCTCAGATTACATGTTCTCTCGAGAGAACATGTAATCTGAGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)