EMAIL THIS PAGE TO A FRIEND

KRTAP3-3

keratin associated protein 3-3

65 Gene Product Result for
Synonyms: KAP3.3 KRTAP3.3
UniProtKB ID: Q9BYR6, Q52LP0, Q6NTD4
Gene ID:
Human(85293) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(66380) keratin associated protein 3-3
Rat(363678) keratin associated protein 3-3
cow(768045) keratin associated protein 3-3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042992 Anti-KRTAP3-3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2107588 Anti-KRTAP3-3 antibody produced in rabbit affinity isolated antibody sheep, mouse, goat, rabbit, horse, human, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228641 MISSION® esiRNA esiRNA targeting human KRTAP3-3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033185 Rosetta Predictions human pricing
XM_343966 Rosetta Predictions rat pricing
NM_025524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158334 predicted 512
2 SASI_Hs01_00158335 predicted 561
3 SASI_Hs01_00158336 predicted 402
4 SASI_Hs01_00158337 predicted 535
5 SASI_Hs01_00158338 predicted 553
6 SASI_Hs01_00158339 predicted 507
7 SASI_Hs01_00158340 predicted 440
8 SASI_Hs01_00158341 predicted 586
9 SASI_Hs01_00158342 predicted 400
10 SASI_Hs01_00158343 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396615 predicted 423
2 SASI_Rn02_00396616 predicted 425
3 SASI_Rn02_00396617 predicted 427
4 SASI_Rn02_00396618 predicted 424
5 SASI_Rn02_00396619 predicted 384
6 SASI_Rn02_00396620 predicted 433
7 SASI_Rn02_00396621 predicted 456
8 SASI_Rn02_00396622 predicted 388
9 SASI_Rn02_00396623 predicted 354
10 SASI_Rn02_00396624 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062505 predicted 428
2 SASI_Mm01_00062506 predicted 287
3 SASI_Mm01_00062507 predicted 269
4 SASI_Mm01_00062508 predicted 507
5 SASI_Mm01_00062509 predicted 423
6 SASI_Mm01_00062510 predicted 421
7 SASI_Mm01_00062512 predicted 450
8 SASI_Mm02_00328435 predicted 452
9 SASI_Mm01_00062513 predicted 406
10 SASI_Mm01_00062514 predicted 455
11 SASI_Mm01_00062511 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033185
KRTAP3-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 3-3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-412s21c1
Sequence:CCGGCAACTAATGTACTCTGCTTTACTCGAGTAAAGCAGAGTACATTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-499s21c1
Sequence:CCGGCAATGACCATTCAGCTATAACCTCGAGGTTATAGCTGAATGGTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-531s21c1
Sequence:CCGGTGAATCAGTGGATGCCTATAGCTCGAGCTATAGGCATCCACTGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-382s21c1
Sequence:CCGGAGCTTTAGCATTCACCTATCTCTCGAGAGATAGGTGAATGCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-564s21c1
Sequence:CCGGGTTCGATTCCTTCATATTAAACTCGAGTTTAATATGAAGGAATCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033185.2-561s1c1
Sequence:CCGGGCTGTTCGATTCCTTCATATTCTCGAGAATATGAAGGAATCGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033185.2-144s1c1
Sequence:CCGGCCCACACACAGTTTGGTTACTCTCGAGAGTAACCAAACTGTGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033185.2-551s1c1
Sequence:CCGGGCTTCCTGAAGCTGTTCGATTCTCGAGAATCGAACAGCTTCAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033185
KRTAP3-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 3-3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-412s21c1
Sequence:CCGGCAACTAATGTACTCTGCTTTACTCGAGTAAAGCAGAGTACATTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-499s21c1
Sequence:CCGGCAATGACCATTCAGCTATAACCTCGAGGTTATAGCTGAATGGTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-531s21c1
Sequence:CCGGTGAATCAGTGGATGCCTATAGCTCGAGCTATAGGCATCCACTGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-382s21c1
Sequence:CCGGAGCTTTAGCATTCACCTATCTCTCGAGAGATAGGTGAATGCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-564s21c1
Sequence:CCGGGTTCGATTCCTTCATATTAAACTCGAGTTTAATATGAAGGAATCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033185.2-561s1c1
Sequence:CCGGGCTGTTCGATTCCTTCATATTCTCGAGAATATGAAGGAATCGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033185.2-144s1c1
Sequence:CCGGCCCACACACAGTTTGGTTACTCTCGAGAGTAACCAAACTGTGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033185.2-551s1c1
Sequence:CCGGGCTTCCTGAAGCTGTTCGATTCTCGAGAATCGAACAGCTTCAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033185
KRTAP3-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 3-3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-412s21c1
Sequence:CCGGCAACTAATGTACTCTGCTTTACTCGAGTAAAGCAGAGTACATTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-499s21c1
Sequence:CCGGCAATGACCATTCAGCTATAACCTCGAGGTTATAGCTGAATGGTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-531s21c1
Sequence:CCGGTGAATCAGTGGATGCCTATAGCTCGAGCTATAGGCATCCACTGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-382s21c1
Sequence:CCGGAGCTTTAGCATTCACCTATCTCTCGAGAGATAGGTGAATGCTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033185.2-564s21c1
Sequence:CCGGGTTCGATTCCTTCATATTAAACTCGAGTTTAATATGAAGGAATCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033185.2-561s1c1
Sequence:CCGGGCTGTTCGATTCCTTCATATTCTCGAGAATATGAAGGAATCGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033185.2-144s1c1
Sequence:CCGGCCCACACACAGTTTGGTTACTCTCGAGAGTAACCAAACTGTGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033185.2-551s1c1
Sequence:CCGGGCTTCCTGAAGCTGTTCGATTCTCGAGAATCGAACAGCTTCAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025524
KRTAP3-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 3-3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-513s1c1
Sequence:CCGGCCAGAGTCTTTGGTAATGCAACTCGAGTTGCATTACCAAAGACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-453s1c1
Sequence:CCGGGAAGTTGGAGTTGAGTGATATCTCGAGATATCACTCAACTCCAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-518s1c1
Sequence:CCGGGTCTTTGGTAATGCAACATTTCTCGAGAAATGTTGCATTACCAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-516s1c1
Sequence:CCGGGAGTCTTTGGTAATGCAACATCTCGAGATGTTGCATTACCAAAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025524
KRTAP3-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 3-3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-513s1c1
Sequence:CCGGCCAGAGTCTTTGGTAATGCAACTCGAGTTGCATTACCAAAGACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-453s1c1
Sequence:CCGGGAAGTTGGAGTTGAGTGATATCTCGAGATATCACTCAACTCCAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-518s1c1
Sequence:CCGGGTCTTTGGTAATGCAACATTTCTCGAGAAATGTTGCATTACCAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-516s1c1
Sequence:CCGGGAGTCTTTGGTAATGCAACATCTCGAGATGTTGCATTACCAAAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025524
KRTAP3-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 3-3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-513s1c1
Sequence:CCGGCCAGAGTCTTTGGTAATGCAACTCGAGTTGCATTACCAAAGACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-453s1c1
Sequence:CCGGGAAGTTGGAGTTGAGTGATATCTCGAGATATCACTCAACTCCAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-518s1c1
Sequence:CCGGGTCTTTGGTAATGCAACATTTCTCGAGAAATGTTGCATTACCAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025524.1-516s1c1
Sequence:CCGGGAGTCTTTGGTAATGCAACATCTCGAGATGTTGCATTACCAAAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)