EMAIL THIS PAGE TO A FRIEND

Krtap31-2

12 Gene Product Result for
Species: Mouse Krtap31-2(432602)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU209571 MISSION® esiRNA targeting mouse Krtap31-2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196147 predicted 616
2 SASI_Mm01_00196148 predicted 643
3 SASI_Mm01_00196149 predicted 716
4 SASI_Mm01_00196150 predicted 628
5 SASI_Mm01_00196152 predicted 628
6 SASI_Mm01_00196153 predicted 652
7 SASI_Mm02_00287801 predicted 803
8 SASI_Mm01_00196154 predicted 781
9 SASI_Mm01_00196155 predicted 874
10 SASI_Mm01_00196156 predicted 768
11 SASI_Mm01_00196151 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025244
Krtap31-2 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-422s1c1
Sequence:CCGGCTGCAAGACCATCTCCTTTAACTCGAGTTAAAGGAGATGGTCTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025244.1-732s1c1
Sequence:CCGGGCTGATATGAAGGTCTGGCATCTCGAGATGCCAGACCTTCATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-182s1c1
Sequence:CCGGACCCTGTTGTTGCAAGTCTATCTCGAGATAGACTTGCAACAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-217s1c1
Sequence:CCGGCCAAGACTGTCAACAGCTGTTCTCGAGAACAGCTGTTGACAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-522s1c1
Sequence:CCGGCTCCCAAAGGAACAAAGCCATCTCGAGATGGCTTTGTTCCTTTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025244
Krtap31-2 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-422s1c1
Sequence:CCGGCTGCAAGACCATCTCCTTTAACTCGAGTTAAAGGAGATGGTCTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025244.1-732s1c1
Sequence:CCGGGCTGATATGAAGGTCTGGCATCTCGAGATGCCAGACCTTCATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-182s1c1
Sequence:CCGGACCCTGTTGTTGCAAGTCTATCTCGAGATAGACTTGCAACAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-217s1c1
Sequence:CCGGCCAAGACTGTCAACAGCTGTTCTCGAGAACAGCTGTTGACAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-522s1c1
Sequence:CCGGCTCCCAAAGGAACAAAGCCATCTCGAGATGGCTTTGTTCCTTTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025244
Krtap31-2 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-422s1c1
Sequence:CCGGCTGCAAGACCATCTCCTTTAACTCGAGTTAAAGGAGATGGTCTTGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000098400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025244.1-732s1c1
Sequence:CCGGGCTGATATGAAGGTCTGGCATCTCGAGATGCCAGACCTTCATATCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000098404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-182s1c1
Sequence:CCGGACCCTGTTGTTGCAAGTCTATCTCGAGATAGACTTGCAACAACAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000098402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-217s1c1
Sequence:CCGGCCAAGACTGTCAACAGCTGTTCTCGAGAACAGCTGTTGACAGTCTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000098401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025244.1-522s1c1
Sequence:CCGGCTCCCAAAGGAACAAAGCCATCTCGAGATGGCTTTGTTCCTTTGGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???