EMAIL THIS PAGE TO A FRIEND

KRTAP4-12

keratin associated protein 4-12

18 Gene Product Result for
Synonyms: KAP4.12 KRTAP4.12
UniProtKB ID: Q9BQ66, A3KMC5, Q495I0
Gene ID:
Human(83755) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
dog(490996) keratin associated protein 4-12
cow(787132) keratin associated protein 4-12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031854 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031854 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163346 predicted 832
2 SASI_Hs01_00163347 predicted 830
3 SASI_Hs01_00163348 predicted 769
4 SASI_Hs01_00163349 predicted 847
5 SASI_Hs01_00163350 predicted 837
6 SASI_Hs01_00163352 predicted 755
7 SASI_Hs02_00358959 predicted 747
8 SASI_Hs02_00358960 predicted 811
9 SASI_Hs02_00358961 predicted 830
10 SASI_Hs01_00163353 predicted 806
11 SASI_Hs01_00163345 predicted 848
12 SASI_Hs01_00163351 predicted 844
13 SASI_Hs01_00163354 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031854
KRTAP4-12 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-12
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-919s1c1
Sequence:CCGGGAATTTGAAGATTGCCTCCATCTCGAGATGGAGGCAATCTTCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-671s1c1
Sequence:CCGGCACTTCCTTATTACGTCCTTTCTCGAGAAAGGACGTAATAAGGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-881s1c1
Sequence:CCGGCCTCTTTGACTTCAGGACATTCTCGAGAATGTCCTGAAGTCAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-719s1c1
Sequence:CCGGCATGCGGACTGTTCAAGAGAACTCGAGTTCTCTTGAACAGTCCGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-763s1c1
Sequence:CCGGCCTCATCCTTAGAAATTCTGTCTCGAGACAGAATTTCTAAGGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-753s1c1
Sequence:CCGGCATAAGCAAACCTCATCCTTACTCGAGTAAGGATGAGGTTTGCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-659s1c1
Sequence:CCGGCTGTGAACACACCACTTCCTTCTCGAGAAGGAAGTGGTGTGTTCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-809s1c1
Sequence:CCGGCTCCCTTCCTTCCAAAGGAATCTCGAGATTCCTTTGGAAGGAAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-751s1c1
Sequence:CCGGCCCATAAGCAAACCTCATCCTCTCGAGAGGATGAGGTTTGCTTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-758s1c1
Sequence:CCGGGCAAACCTCATCCTTAGAAATCTCGAGATTTCTAAGGATGAGGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-737s1c1
Sequence:CCGGGAATTGATCTGGGTCCCATAACTCGAGTTATGGGACCCAGATCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-882s1c1
Sequence:CCGGCTCTTTGACTTCAGGACATTTCTCGAGAAATGTCCTGAAGTCAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-735s1c1
Sequence:CCGGGAGAATTGATCTGGGTCCCATCTCGAGATGGGACCCAGATCAATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-692s1c1
Sequence:CCGGCCTACAGATGAAGGCTCTCATCTCGAGATGAGAGCCTTCATCTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-670s1c1
Sequence:CCGGCCACTTCCTTATTACGTCCTTCTCGAGAAGGACGTAATAAGGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031854
KRTAP4-12 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-12
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-919s1c1
Sequence:CCGGGAATTTGAAGATTGCCTCCATCTCGAGATGGAGGCAATCTTCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-671s1c1
Sequence:CCGGCACTTCCTTATTACGTCCTTTCTCGAGAAAGGACGTAATAAGGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-881s1c1
Sequence:CCGGCCTCTTTGACTTCAGGACATTCTCGAGAATGTCCTGAAGTCAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-719s1c1
Sequence:CCGGCATGCGGACTGTTCAAGAGAACTCGAGTTCTCTTGAACAGTCCGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-763s1c1
Sequence:CCGGCCTCATCCTTAGAAATTCTGTCTCGAGACAGAATTTCTAAGGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-753s1c1
Sequence:CCGGCATAAGCAAACCTCATCCTTACTCGAGTAAGGATGAGGTTTGCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-659s1c1
Sequence:CCGGCTGTGAACACACCACTTCCTTCTCGAGAAGGAAGTGGTGTGTTCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-809s1c1
Sequence:CCGGCTCCCTTCCTTCCAAAGGAATCTCGAGATTCCTTTGGAAGGAAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-751s1c1
Sequence:CCGGCCCATAAGCAAACCTCATCCTCTCGAGAGGATGAGGTTTGCTTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-758s1c1
Sequence:CCGGGCAAACCTCATCCTTAGAAATCTCGAGATTTCTAAGGATGAGGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-737s1c1
Sequence:CCGGGAATTGATCTGGGTCCCATAACTCGAGTTATGGGACCCAGATCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-882s1c1
Sequence:CCGGCTCTTTGACTTCAGGACATTTCTCGAGAAATGTCCTGAAGTCAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-735s1c1
Sequence:CCGGGAGAATTGATCTGGGTCCCATCTCGAGATGGGACCCAGATCAATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-692s1c1
Sequence:CCGGCCTACAGATGAAGGCTCTCATCTCGAGATGAGAGCCTTCATCTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-670s1c1
Sequence:CCGGCCACTTCCTTATTACGTCCTTCTCGAGAAGGACGTAATAAGGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031854
KRTAP4-12 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-12
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-919s1c1
Sequence:CCGGGAATTTGAAGATTGCCTCCATCTCGAGATGGAGGCAATCTTCAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-671s1c1
Sequence:CCGGCACTTCCTTATTACGTCCTTTCTCGAGAAAGGACGTAATAAGGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-881s1c1
Sequence:CCGGCCTCTTTGACTTCAGGACATTCTCGAGAATGTCCTGAAGTCAAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-719s1c1
Sequence:CCGGCATGCGGACTGTTCAAGAGAACTCGAGTTCTCTTGAACAGTCCGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-763s1c1
Sequence:CCGGCCTCATCCTTAGAAATTCTGTCTCGAGACAGAATTTCTAAGGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-753s1c1
Sequence:CCGGCATAAGCAAACCTCATCCTTACTCGAGTAAGGATGAGGTTTGCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-659s1c1
Sequence:CCGGCTGTGAACACACCACTTCCTTCTCGAGAAGGAAGTGGTGTGTTCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-809s1c1
Sequence:CCGGCTCCCTTCCTTCCAAAGGAATCTCGAGATTCCTTTGGAAGGAAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-751s1c1
Sequence:CCGGCCCATAAGCAAACCTCATCCTCTCGAGAGGATGAGGTTTGCTTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-758s1c1
Sequence:CCGGGCAAACCTCATCCTTAGAAATCTCGAGATTTCTAAGGATGAGGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-737s1c1
Sequence:CCGGGAATTGATCTGGGTCCCATAACTCGAGTTATGGGACCCAGATCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-882s1c1
Sequence:CCGGCTCTTTGACTTCAGGACATTTCTCGAGAAATGTCCTGAAGTCAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-735s1c1
Sequence:CCGGGAGAATTGATCTGGGTCCCATCTCGAGATGGGACCCAGATCAATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-692s1c1
Sequence:CCGGCCTACAGATGAAGGCTCTCATCTCGAGATGAGAGCCTTCATCTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031854.2-670s1c1
Sequence:CCGGCCACTTCCTTATTACGTCCTTCTCGAGAAGGACGTAATAAGGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)