EMAIL THIS PAGE TO A FRIEND

KRTAP4-1

keratin associated protein 4-1

36 Gene Product Result for
Synonyms: KAP4.1 KAP4.10 KRTAP4-10 KRTAP4.10
UniProtKB ID: Q9BYQ7, A8MWS7, Q3SYF2
Gene ID:
Human(85285) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(665891) keratin associated protein 4-1
cow(788196) keratin associated protein 4-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001048196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001048196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001048196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033060 Rosetta Predictions human pricing
NM_001048196 Rosetta Predictions mouse pricing
XM_980125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133559 predicted 444
2 SASI_Hs01_00133561 predicted 450
3 SASI_Hs01_00133562 predicted 513
4 SASI_Hs01_00133563 predicted 483
5 SASI_Hs01_00133564 predicted 422
6 SASI_Hs01_00133565 predicted 404
7 SASI_Hs01_00133566 predicted 501
8 SASI_Hs01_00133567 predicted 418
9 SASI_Hs01_00133568 predicted 456
10 SASI_Hs02_00360758 predicted 462
11 SASI_Hs01_00133560 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292180 predicted 711
2 SASI_Mm02_00292181 predicted 768
3 SASI_Mm02_00292182 predicted 713
4 SASI_Mm02_00292183 predicted 658
5 SASI_Mm02_00292184 predicted 785
6 SASI_Mm02_00292185 predicted 679
7 SASI_Mm02_00292186 predicted 679
8 SASI_Mm02_00292187 predicted 770
9 SASI_Mm02_00292188 predicted 717
10 SASI_Mm02_00292189 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268793 predicted 845
2 SASI_Mm01_00268794 predicted 785
3 SASI_Mm01_00268795 predicted 912
4 SASI_Mm01_00268796 predicted 865
5 SASI_Mm01_00268797 predicted 831
6 SASI_Mm01_00268798 predicted 808
7 SASI_Mm01_00268799 predicted 869
8 SASI_Mm01_00268800 predicted 895
9 SASI_Mm01_00268801 predicted 819
10 SASI_Mm01_00268802 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033060
KRTAP4-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-565s1c1
Sequence:CCGGCCATCTACATTTAATACCACTCTCGAGAGTGGTATTAAATGTAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-497s1c1
Sequence:CCGGGTCCATGTGTTAAATGGCCATCTCGAGATGGCCATTTAACACATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-555s1c1
Sequence:CCGGGAAAGGGCATCCATCTACATTCTCGAGAATGTAGATGGATGCCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-595s1c1
Sequence:CCGGCATGGATCTCTTCCCAGCATTCTCGAGAATGCTGGGAAGAGATCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033060.2-369s21c1
Sequence:CCGGACCACCTGCTGCCGTACAACTCTCGAGAGTTGTACGGCAGCAGGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033060.2-517s21c1
Sequence:CCGGTCAGCTTTATTATCCTGTTATCTCGAGATAACAGGATAATAAAGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033060.2-412s21c1
Sequence:CCGGGATCCTCTTGTTGAACCTCATCTCGAGATGAGGTTCAACAAGAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033060
KRTAP4-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-565s1c1
Sequence:CCGGCCATCTACATTTAATACCACTCTCGAGAGTGGTATTAAATGTAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-497s1c1
Sequence:CCGGGTCCATGTGTTAAATGGCCATCTCGAGATGGCCATTTAACACATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-555s1c1
Sequence:CCGGGAAAGGGCATCCATCTACATTCTCGAGAATGTAGATGGATGCCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-595s1c1
Sequence:CCGGCATGGATCTCTTCCCAGCATTCTCGAGAATGCTGGGAAGAGATCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033060.2-369s21c1
Sequence:CCGGACCACCTGCTGCCGTACAACTCTCGAGAGTTGTACGGCAGCAGGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033060.2-517s21c1
Sequence:CCGGTCAGCTTTATTATCCTGTTATCTCGAGATAACAGGATAATAAAGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033060.2-412s21c1
Sequence:CCGGGATCCTCTTGTTGAACCTCATCTCGAGATGAGGTTCAACAAGAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033060
KRTAP4-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-565s1c1
Sequence:CCGGCCATCTACATTTAATACCACTCTCGAGAGTGGTATTAAATGTAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-497s1c1
Sequence:CCGGGTCCATGTGTTAAATGGCCATCTCGAGATGGCCATTTAACACATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-555s1c1
Sequence:CCGGGAAAGGGCATCCATCTACATTCTCGAGAATGTAGATGGATGCCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033060.2-595s1c1
Sequence:CCGGCATGGATCTCTTCCCAGCATTCTCGAGAATGCTGGGAAGAGATCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033060.2-369s21c1
Sequence:CCGGACCACCTGCTGCCGTACAACTCTCGAGAGTTGTACGGCAGCAGGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033060.2-517s21c1
Sequence:CCGGTCAGCTTTATTATCCTGTTATCTCGAGATAACAGGATAATAAAGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033060.2-412s21c1
Sequence:CCGGGATCCTCTTGTTGAACCTCATCTCGAGATGAGGTTCAACAAGAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048196
KRTAP4-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-583s21c1
Sequence:CCGGCACATCTCCACGTACAGATATCTCGAGATATCTGTACGTGGAGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-749s21c1
Sequence:CCGGACCATGTCTTTCTAATGTTTGCTCGAGCAAACATTAGAAAGACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-832s21c1
Sequence:CCGGTTGACTTTGTAGCTCTAAATTCTCGAGAATTTAGAGCTACAAAGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-717s21c1
Sequence:CCGGCTCCTGGCTCACATTACATTCCTCGAGGAATGTAATGTGAGCCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-638s21c1
Sequence:CCGGGGAATCTGTTTGGCATCATTTCTCGAGAAATGATGCCAAACAGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048196
KRTAP4-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-583s21c1
Sequence:CCGGCACATCTCCACGTACAGATATCTCGAGATATCTGTACGTGGAGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-749s21c1
Sequence:CCGGACCATGTCTTTCTAATGTTTGCTCGAGCAAACATTAGAAAGACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-832s21c1
Sequence:CCGGTTGACTTTGTAGCTCTAAATTCTCGAGAATTTAGAGCTACAAAGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-717s21c1
Sequence:CCGGCTCCTGGCTCACATTACATTCCTCGAGGAATGTAATGTGAGCCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-638s21c1
Sequence:CCGGGGAATCTGTTTGGCATCATTTCTCGAGAAATGATGCCAAACAGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048196
KRTAP4-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-583s21c1
Sequence:CCGGCACATCTCCACGTACAGATATCTCGAGATATCTGTACGTGGAGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-749s21c1
Sequence:CCGGACCATGTCTTTCTAATGTTTGCTCGAGCAAACATTAGAAAGACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-832s21c1
Sequence:CCGGTTGACTTTGTAGCTCTAAATTCTCGAGAATTTAGAGCTACAAAGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-717s21c1
Sequence:CCGGCTCCTGGCTCACATTACATTCCTCGAGGAATGTAATGTGAGCCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048196.1-638s21c1
Sequence:CCGGGGAATCTGTTTGGCATCATTTCTCGAGAAATGATGCCAAACAGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)