EMAIL THIS PAGE TO A FRIEND

KRTAP4-2

keratin associated protein 4-2

34 Gene Product Result for
Synonyms: KAP4.2 KRTAP4.2
UniProtKB ID: Q9BYR5, A0JP64
Gene ID:
Human(85291) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(68673) keratin associated protein 4-2
Rat(680286) keratin associated protein 4-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033062 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172641 MISSION® esiRNA esiRNA targeting mouse Krtap4-2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033062 Rosetta Predictions human pricing
XM_001056463 Rosetta Predictions rat pricing
NM_026807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039051 predicted 481
2 SASI_Hs02_00360760 predicted 508
3 SASI_Hs01_00039052 predicted 470
4 SASI_Hs01_00039053 predicted 521
5 SASI_Hs01_00039054 predicted 472
6 SASI_Hs01_00039056 predicted 459
7 SASI_Hs01_00039057 predicted 487
8 SASI_Hs01_00039058 predicted 446
9 SASI_Hs02_00360761 predicted 475
10 SASI_Hs01_00039059 predicted 465
11 SASI_Hs01_00039055 predicted 461
12 SASI_Hs01_00039060 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283376 predicted 615
2 SASI_Rn02_00283377 predicted 686
3 SASI_Rn02_00283378 predicted 615
4 SASI_Rn02_00283379 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330939 predicted 677
2 SASI_Mm01_00043391 predicted 690
3 SASI_Mm01_00043393 predicted 629
4 SASI_Mm01_00043394 predicted 663
5 SASI_Mm01_00043396 predicted 734
6 SASI_Mm01_00043397 predicted 622
7 SASI_Mm01_00043398 predicted 623
8 SASI_Mm01_00043399 predicted 626
9 SASI_Mm01_00043400 predicted 663
10 SASI_Mm02_00330940 predicted 623
11 SASI_Mm01_00043392 predicted 668
12 SASI_Mm01_00043395 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026807
KRTAP4-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-309s1c1
Sequence:CCGGGCTGTCAACCCTCCTGTGGTACTCGAGTACCACAGGAGGGTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-129s1c1
Sequence:CCGGGCTGCCAAACCACCTGCTGTACTCGAGTACAGCAGGTGGTTTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026807.1-749s1c1
Sequence:CCGGCCTCCAAATAGCTTAACAGATCTCGAGATCTGTTAAGCTATTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-333s1c1
Sequence:CCGGCCAGCTGCTGTGGTTCTAGTTCTCGAGAACTAGAACCACAGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-481s1c1
Sequence:CCGGCTGCTGCCAAACCACTTGCTACTCGAGTAGCAAGTGGTTTGGCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026807
KRTAP4-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-309s1c1
Sequence:CCGGGCTGTCAACCCTCCTGTGGTACTCGAGTACCACAGGAGGGTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-129s1c1
Sequence:CCGGGCTGCCAAACCACCTGCTGTACTCGAGTACAGCAGGTGGTTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026807.1-749s1c1
Sequence:CCGGCCTCCAAATAGCTTAACAGATCTCGAGATCTGTTAAGCTATTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-333s1c1
Sequence:CCGGCCAGCTGCTGTGGTTCTAGTTCTCGAGAACTAGAACCACAGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-481s1c1
Sequence:CCGGCTGCTGCCAAACCACTTGCTACTCGAGTAGCAAGTGGTTTGGCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026807
KRTAP4-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-309s1c1
Sequence:CCGGGCTGTCAACCCTCCTGTGGTACTCGAGTACCACAGGAGGGTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-129s1c1
Sequence:CCGGGCTGCCAAACCACCTGCTGTACTCGAGTACAGCAGGTGGTTTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026807.1-749s1c1
Sequence:CCGGCCTCCAAATAGCTTAACAGATCTCGAGATCTGTTAAGCTATTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-333s1c1
Sequence:CCGGCCAGCTGCTGTGGTTCTAGTTCTCGAGAACTAGAACCACAGCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026807.1-481s1c1
Sequence:CCGGCTGCTGCCAAACCACTTGCTACTCGAGTAGCAAGTGGTTTGGCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033062
KRTAP4-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033062.2-579s1c1
Sequence:CCGGCCTCCAAATATGCTCACCAAACTCGAGTTTGGTGAGCATATTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-281s1c1
Sequence:CCGGCTGCTGTGTGTCCAGCTGCTTCTCGAGAAGCAGCTGGACACACAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-85s1c1
Sequence:CCGGGCTGTGGCCTAGAGAACTGCTCTCGAGAGCAGTTCTCTAGGCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-80s1c1
Sequence:CCGGCCAGGGCTGTGGCCTAGAGAACTCGAGTTCTCTAGGCCACAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-430s1c1
Sequence:CCGGCCTGCTCTAGTGGCTCTTGCTCTCGAGAGCAAGAGCCACTAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033062.2-463s21c1
Sequence:CCGGACCTATACTCACCTGCCTTTACTCGAGTAAAGGCAGGTGAGTATAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033062.2-450s21c1
Sequence:CCGGTGCTGATGCCCTCACCTATACCTCGAGGTATAGGTGAGGGCATCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033062.2-520s21c1
Sequence:CCGGGAATCATGCAAGGCCAATTGGCTCGAGCCAATTGGCCTTGCATGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033062
KRTAP4-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033062.2-579s1c1
Sequence:CCGGCCTCCAAATATGCTCACCAAACTCGAGTTTGGTGAGCATATTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-281s1c1
Sequence:CCGGCTGCTGTGTGTCCAGCTGCTTCTCGAGAAGCAGCTGGACACACAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-85s1c1
Sequence:CCGGGCTGTGGCCTAGAGAACTGCTCTCGAGAGCAGTTCTCTAGGCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-80s1c1
Sequence:CCGGCCAGGGCTGTGGCCTAGAGAACTCGAGTTCTCTAGGCCACAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-430s1c1
Sequence:CCGGCCTGCTCTAGTGGCTCTTGCTCTCGAGAGCAAGAGCCACTAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033062.2-463s21c1
Sequence:CCGGACCTATACTCACCTGCCTTTACTCGAGTAAAGGCAGGTGAGTATAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033062.2-450s21c1
Sequence:CCGGTGCTGATGCCCTCACCTATACCTCGAGGTATAGGTGAGGGCATCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033062.2-520s21c1
Sequence:CCGGGAATCATGCAAGGCCAATTGGCTCGAGCCAATTGGCCTTGCATGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033062
KRTAP4-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033062.2-579s1c1
Sequence:CCGGCCTCCAAATATGCTCACCAAACTCGAGTTTGGTGAGCATATTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-281s1c1
Sequence:CCGGCTGCTGTGTGTCCAGCTGCTTCTCGAGAAGCAGCTGGACACACAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-85s1c1
Sequence:CCGGGCTGTGGCCTAGAGAACTGCTCTCGAGAGCAGTTCTCTAGGCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-80s1c1
Sequence:CCGGCCAGGGCTGTGGCCTAGAGAACTCGAGTTCTCTAGGCCACAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033062.2-430s1c1
Sequence:CCGGCCTGCTCTAGTGGCTCTTGCTCTCGAGAGCAAGAGCCACTAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033062.2-463s21c1
Sequence:CCGGACCTATACTCACCTGCCTTTACTCGAGTAAAGGCAGGTGAGTATAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033062.2-450s21c1
Sequence:CCGGTGCTGATGCCCTCACCTATACCTCGAGGTATAGGTGAGGGCATCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033062.2-520s21c1
Sequence:CCGGGAATCATGCAAGGCCAATTGGCTCGAGCCAATTGGCCTTGCATGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)