EMAIL THIS PAGE TO A FRIEND

KRTAP4-3

keratin associated protein 4-3

40 Gene Product Result for
Synonyms: KAP4.3
UniProtKB ID: Q9BYR4
Gene ID:
Rat(501725) keratin associated protein 4-3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033187 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033187 Rosetta Predictions human pricing
XM_497545 Rosetta Predictions human pricing
XM_001081433 Rosetta Predictions rat pricing
XM_577126 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360966 predicted 664
2 SASI_Hs02_00360967 predicted 609
3 SASI_Hs02_00360968 predicted 592
4 SASI_Hs02_00360969 predicted 597
5 SASI_Hs02_00360970 predicted 623
6 SASI_Hs02_00360971 predicted 647
7 SASI_Hs02_00360972 predicted 589
8 SASI_Hs02_00360973 predicted 686
9 SASI_Hs02_00360974 predicted 567
10 SASI_Hs02_00360975 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282556 predicted 684
2 SASI_Hs01_00282557 predicted 612
3 SASI_Hs01_00282558 predicted 615
4 SASI_Hs01_00282559 predicted 649
5 SASI_Hs01_00282560 predicted 676
6 SASI_Hs01_00282561 predicted 615
7 SASI_Hs01_00282562 predicted 710
8 SASI_Hs01_00282563 predicted 591
9 SASI_Hs01_00282564 predicted 687
10 SASI_Hs01_00282565 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371855 predicted 335
2 SASI_Rn02_00371856 predicted 333
3 SASI_Rn02_00371857 predicted 229
4 SASI_Rn02_00371858 predicted 219
5 SASI_Rn02_00371859 predicted 253
6 SASI_Rn02_00371860 predicted 251
7 SASI_Rn02_00371861 predicted 326
8 SASI_Rn02_00371862 predicted 281
9 SASI_Rn02_00371863 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406230 predicted 333
2 SASI_Rn02_00406231 predicted 339
3 SASI_Rn02_00406232 predicted 231
4 SASI_Rn02_00406233 predicted 221
5 SASI_Rn02_00406234 predicted 252
6 SASI_Rn02_00406235 predicted 254
7 SASI_Rn02_00406236 predicted 325
8 SASI_Rn02_00406237 predicted 274
9 SASI_Rn02_00406238 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033187
KRTAP4-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-454s21c1
Sequence:CCGGCCGGCTTGCTGCATTTCTAGTCTCGAGACTAGAAATGCAGCAAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-527s21c1
Sequence:CCGGCGACCACCTGCTGTAGAACAACTCGAGTTGTTCTACAGCAGGTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-344s21c1
Sequence:CCGGGTATCTCTAGCTGTTGCAAACCTCGAGGTTTGCAACAGCTAGAGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033187.1-635s21c1
Sequence:CCGGTTCAGGCACAGAGTATCTATTCTCGAGAATAGATACTCTGTGCCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033187
KRTAP4-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-454s21c1
Sequence:CCGGCCGGCTTGCTGCATTTCTAGTCTCGAGACTAGAAATGCAGCAAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-527s21c1
Sequence:CCGGCGACCACCTGCTGTAGAACAACTCGAGTTGTTCTACAGCAGGTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-344s21c1
Sequence:CCGGGTATCTCTAGCTGTTGCAAACCTCGAGGTTTGCAACAGCTAGAGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033187.1-635s21c1
Sequence:CCGGTTCAGGCACAGAGTATCTATTCTCGAGAATAGATACTCTGTGCCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033187
KRTAP4-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-454s21c1
Sequence:CCGGCCGGCTTGCTGCATTTCTAGTCTCGAGACTAGAAATGCAGCAAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-527s21c1
Sequence:CCGGCGACCACCTGCTGTAGAACAACTCGAGTTGTTCTACAGCAGGTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033187.1-344s21c1
Sequence:CCGGGTATCTCTAGCTGTTGCAAACCTCGAGGTTTGCAACAGCTAGAGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033187.1-635s21c1
Sequence:CCGGTTCAGGCACAGAGTATCTATTCTCGAGAATAGATACTCTGTGCCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)