EMAIL THIS PAGE TO A FRIEND

KRTAP4-4

keratin associated protein 4-4

17 Gene Product Result for
Synonyms: KAP4.13 KAP4.4 KRTAP4-13 KRTAP4.13 KRTAP4.4
Species: Human KRTAP4-4(84616)
UniProtKB ID: Q9BYR3, Q9BYU7
Gene ID:
Human(84616) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032524 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234766 predicted 310
2 SASI_Hs01_00234767 predicted 913
3 SASI_Hs01_00234768 predicted 764
4 SASI_Hs01_00234769 predicted 732
5 SASI_Hs01_00234770 predicted 799
6 SASI_Hs01_00234771 predicted 511
7 SASI_Hs01_00234772 predicted 609
8 SASI_Hs01_00234775 predicted 809
9 SASI_Hs02_00360023 predicted 751
10 SASI_Hs02_00360024 predicted 789
11 SASI_Hs01_00234773 predicted 543
12 SASI_Hs01_00234774 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032524
KRTAP4-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-829s1c1
Sequence:CCGGGCTGAGTTATGGGAAGCTAGTCTCGAGACTAGCTTCCCATAACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-823s1c1
Sequence:CCGGCTATGAGCTGAGTTATGGGAACTCGAGTTCCCATAACTCAGCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-879s1c1
Sequence:CCGGGATTGAATCTGGCCTCCAAATCTCGAGATTTGGAGGCCAGATTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-818s1c1
Sequence:CCGGCTCATCTATGAGCTGAGTTATCTCGAGATAACTCAGCTCATAGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-857s1c1
Sequence:CCGGCTTCAGTTCCAACCAATTCTTCTCGAGAAGAATTGGTTGGAACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032524.1-528s21c1
Sequence:CCGGCTCTATGCTGCTAGCCCATCTCTCGAGAGATGGGCTAGCAGCATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032524.1-922s21c1
Sequence:CCGGCTCTCTACCAAATGAACATAACTCGAGTTATGTTCATTTGGTAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032524.1-738s21c1
Sequence:CCGGCAACCTGCTCTAGTGCTTCTTCTCGAGAAGAAGCACTAGAGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-827s1c1
Sequence:CCGGGAGCTGAGTTATGGGAAGCTACTCGAGTAGCTTCCCATAACTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-817s1c1
Sequence:CCGGGCTCATCTATGAGCTGAGTTACTCGAGTAACTCAGCTCATAGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-830s1c1
Sequence:CCGGCTGAGTTATGGGAAGCTAGTTCTCGAGAACTAGCTTCCCATAACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032524
KRTAP4-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-829s1c1
Sequence:CCGGGCTGAGTTATGGGAAGCTAGTCTCGAGACTAGCTTCCCATAACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-823s1c1
Sequence:CCGGCTATGAGCTGAGTTATGGGAACTCGAGTTCCCATAACTCAGCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-879s1c1
Sequence:CCGGGATTGAATCTGGCCTCCAAATCTCGAGATTTGGAGGCCAGATTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-818s1c1
Sequence:CCGGCTCATCTATGAGCTGAGTTATCTCGAGATAACTCAGCTCATAGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-857s1c1
Sequence:CCGGCTTCAGTTCCAACCAATTCTTCTCGAGAAGAATTGGTTGGAACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032524.1-528s21c1
Sequence:CCGGCTCTATGCTGCTAGCCCATCTCTCGAGAGATGGGCTAGCAGCATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032524.1-922s21c1
Sequence:CCGGCTCTCTACCAAATGAACATAACTCGAGTTATGTTCATTTGGTAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032524.1-738s21c1
Sequence:CCGGCAACCTGCTCTAGTGCTTCTTCTCGAGAAGAAGCACTAGAGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-827s1c1
Sequence:CCGGGAGCTGAGTTATGGGAAGCTACTCGAGTAGCTTCCCATAACTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-817s1c1
Sequence:CCGGGCTCATCTATGAGCTGAGTTACTCGAGTAACTCAGCTCATAGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-830s1c1
Sequence:CCGGCTGAGTTATGGGAAGCTAGTTCTCGAGAACTAGCTTCCCATAACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032524
KRTAP4-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-829s1c1
Sequence:CCGGGCTGAGTTATGGGAAGCTAGTCTCGAGACTAGCTTCCCATAACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-823s1c1
Sequence:CCGGCTATGAGCTGAGTTATGGGAACTCGAGTTCCCATAACTCAGCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-879s1c1
Sequence:CCGGGATTGAATCTGGCCTCCAAATCTCGAGATTTGGAGGCCAGATTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-818s1c1
Sequence:CCGGCTCATCTATGAGCTGAGTTATCTCGAGATAACTCAGCTCATAGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-857s1c1
Sequence:CCGGCTTCAGTTCCAACCAATTCTTCTCGAGAAGAATTGGTTGGAACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032524.1-528s21c1
Sequence:CCGGCTCTATGCTGCTAGCCCATCTCTCGAGAGATGGGCTAGCAGCATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032524.1-922s21c1
Sequence:CCGGCTCTCTACCAAATGAACATAACTCGAGTTATGTTCATTTGGTAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032524.1-738s21c1
Sequence:CCGGCAACCTGCTCTAGTGCTTCTTCTCGAGAAGAAGCACTAGAGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-827s1c1
Sequence:CCGGGAGCTGAGTTATGGGAAGCTACTCGAGTAGCTTCCCATAACTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-817s1c1
Sequence:CCGGGCTCATCTATGAGCTGAGTTACTCGAGTAACTCAGCTCATAGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032524.1-830s1c1
Sequence:CCGGCTGAGTTATGGGAAGCTAGTTCTCGAGAACTAGCTTCCCATAACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)