EMAIL THIS PAGE TO A FRIEND

KRTAP4-6

keratin associated protein 4-6

60 Gene Product Result for
Synonyms: KAP4.15 KAP4.6 KRTAP4-15 KRTAP4.15
UniProtKB ID: Q9BYQ5, Q9BYR1
Gene ID:
Mouse(68768) keratin associated protein 4-6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714702 Rosetta Predictions human pricing
XM_926610 Rosetta Predictions human pricing
XM_937152 Rosetta Predictions human pricing
NM_026834 Rosetta Predictions mouse pricing
XM_980319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398840 predicted 970
2 SASI_Hs02_00398841 predicted 976
3 SASI_Hs02_00398842 predicted 984
4 SASI_Hs02_00398843 predicted 931
5 SASI_Hs02_00398844 predicted 975
6 SASI_Hs02_00398845 predicted 965
7 SASI_Hs02_00398846 predicted 932
8 SASI_Hs02_00398847 predicted 950
9 SASI_Hs02_00398848 predicted 209
10 SASI_Hs02_00398849 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480387 predicted 206
2 SASI_Hs02_00480388 predicted 210
3 SASI_Hs01_00255882 predicted 977
4 SASI_Hs02_00480389 predicted 57
5 SASI_Hs02_00480390 predicted 995
6 SASI_Hs02_00480391 predicted 47
7 SASI_Hs01_00255886 predicted 1116
8 SASI_Hs02_00480392 predicted 968
9 SASI_Hs02_00480393 predicted 147
10 SASI_Hs02_00480394 predicted 36
11 SASI_Hs01_00255883 predicted 961
12 SASI_Hs01_00255884 predicted 614
13 SASI_Hs01_00255885 predicted 826
14 SASI_Hs01_00255887 predicted 931
15 SASI_Hs01_00255888 predicted 666
16 SASI_Hs01_00255889 predicted 952
17 SASI_Hs01_00255890 predicted 734
18 SASI_Hs01_00255891 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482458 predicted 975
2 SASI_Hs02_00482459 predicted 994
3 SASI_Hs02_00482460 predicted 994
4 SASI_Hs02_00482461 predicted 948
5 SASI_Hs02_00482462 predicted 991
6 SASI_Hs02_00482463 predicted 978
7 SASI_Hs02_00482464 predicted 944
8 SASI_Hs02_00482465 predicted 961
9 SASI_Hs02_00482466 predicted 211
10 SASI_Hs02_00482467 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331006 predicted 476
2 SASI_Mm02_00331007 predicted 737
3 SASI_Mm02_00331008 predicted 747
4 SASI_Mm02_00331009 predicted 773
5 SASI_Mm02_00331010 predicted 677
6 SASI_Mm02_00331011 predicted 838
7 SASI_Mm02_00331012 predicted 842
8 SASI_Mm02_00331013 predicted 643
9 SASI_Mm02_00331014 predicted 774
10 SASI_Mm02_00331015 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223432 predicted 746
2 SASI_Mm01_00223433 predicted 748
3 SASI_Mm01_00223434 predicted 783
4 SASI_Mm01_00223435 predicted 679
5 SASI_Mm01_00223436 predicted 853
6 SASI_Mm01_00223437 predicted 849
7 SASI_Mm01_00223438 predicted 646
8 SASI_Mm01_00223439 predicted 848
9 SASI_Mm01_00223440 predicted 777
10 SASI_Mm01_00223441 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026834
KRTAP4-6 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-718s21c1
Sequence:CCGGGGTCAATCAAAGCCTCTGTTGCTCGAGCAACAGAGGCTTTGATTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026834.2-649s21c1
Sequence:CCGGAGCACCTTCATCCAGTCTTCACTCGAGTGAAGACTGGATGAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026834.2-478s21c1
Sequence:CCGGCTGCAGACCTAGCTGTTGCATCTCGAGATGCAACAGCTAGGTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-682s21c1
Sequence:CCGGTCTTAATATAGACCATGAATGCTCGAGCATTCATGGTCTATATTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-740s21c1
Sequence:CCGGATCTTGACTTAGGCTCCAAATCTCGAGATTTGGAGCCTAAGTCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026834
KRTAP4-6 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-718s21c1
Sequence:CCGGGGTCAATCAAAGCCTCTGTTGCTCGAGCAACAGAGGCTTTGATTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026834.2-649s21c1
Sequence:CCGGAGCACCTTCATCCAGTCTTCACTCGAGTGAAGACTGGATGAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026834.2-478s21c1
Sequence:CCGGCTGCAGACCTAGCTGTTGCATCTCGAGATGCAACAGCTAGGTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-682s21c1
Sequence:CCGGTCTTAATATAGACCATGAATGCTCGAGCATTCATGGTCTATATTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-740s21c1
Sequence:CCGGATCTTGACTTAGGCTCCAAATCTCGAGATTTGGAGCCTAAGTCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026834
KRTAP4-6 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-718s21c1
Sequence:CCGGGGTCAATCAAAGCCTCTGTTGCTCGAGCAACAGAGGCTTTGATTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026834.2-649s21c1
Sequence:CCGGAGCACCTTCATCCAGTCTTCACTCGAGTGAAGACTGGATGAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026834.2-478s21c1
Sequence:CCGGCTGCAGACCTAGCTGTTGCATCTCGAGATGCAACAGCTAGGTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-682s21c1
Sequence:CCGGTCTTAATATAGACCATGAATGCTCGAGCATTCATGGTCTATATTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026834.2-740s21c1
Sequence:CCGGATCTTGACTTAGGCTCCAAATCTCGAGATTTGGAGCCTAAGTCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)