EMAIL THIS PAGE TO A FRIEND

KRTAP4-7

keratin associated protein 4-7

21 Gene Product Result for
Synonyms: KAP4.7 KRTAP4.7
UniProtKB ID: Q9BYR0, A0AVM6, A8MQ08, A8MTL4
Gene ID:
Human(100132476) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Mar 2009]
Mouse(76444) keratin associated protein 4-7
Rat(680195) keratin associated protein 4-7
cow(618486) keratin associated protein 4-7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001056094 Rosetta Predictions rat pricing
NM_029613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281994 predicted 198
2 SASI_Rn02_00281995 predicted 197
3 SASI_Rn02_00281996 predicted 189
4 SASI_Rn02_00281997 predicted 195
5 SASI_Rn02_00281998 predicted 184
6 SASI_Rn02_00281999 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180497 predicted 684
2 SASI_Mm01_00180498 predicted 679
3 SASI_Mm01_00180499 predicted 649
4 SASI_Mm01_00180500 predicted 611
5 SASI_Mm01_00180501 predicted 570
6 SASI_Mm01_00180502 predicted 672
7 SASI_Mm01_00180503 predicted 720
8 SASI_Mm01_00180504 predicted 692
9 SASI_Mm01_00180506 predicted 643
10 SASI_Mm02_00335598 predicted 691
11 SASI_Mm01_00180505 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029613
KRTAP4-7 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-764s21c1
Sequence:CCGGCACCAGCTGCTGAATTGAATCCTCGAGGATTCAATTCAGCAGCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-630s21c1
Sequence:CCGGTCATATCGATGGATGTTGTTTCTCGAGAAACAACATCCATCGATATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-688s21c1
Sequence:CCGGATGGCTATTCTAGCTTCAATCCTCGAGGATTGAAGCTAGAATAGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029613.1-652s1c1
Sequence:CCGGGCTGAGTAACATCTCTATATTCTCGAGAATATAGAGATGTTACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-370s1c1
Sequence:CCGGCAACCATCTTGTGGTGGTTCTCTCGAGAGAACCACCACAAGATGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-368s1c1
Sequence:CCGGGCCAACCATCTTGTGGTGGTTCTCGAGAACCACCACAAGATGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-374s1c1
Sequence:CCGGCATCTTGTGGTGGTTCTAGCTCTCGAGAGCTAGAACCACCACAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-224s1c1
Sequence:CCGGCCAGCTGCTGTAGGCCCAGTTCTCGAGAACTGGGCCTACAGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029613
KRTAP4-7 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-764s21c1
Sequence:CCGGCACCAGCTGCTGAATTGAATCCTCGAGGATTCAATTCAGCAGCTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-630s21c1
Sequence:CCGGTCATATCGATGGATGTTGTTTCTCGAGAAACAACATCCATCGATATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-688s21c1
Sequence:CCGGATGGCTATTCTAGCTTCAATCCTCGAGGATTGAAGCTAGAATAGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029613.1-652s1c1
Sequence:CCGGGCTGAGTAACATCTCTATATTCTCGAGAATATAGAGATGTTACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-370s1c1
Sequence:CCGGCAACCATCTTGTGGTGGTTCTCTCGAGAGAACCACCACAAGATGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-368s1c1
Sequence:CCGGGCCAACCATCTTGTGGTGGTTCTCGAGAACCACCACAAGATGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-374s1c1
Sequence:CCGGCATCTTGTGGTGGTTCTAGCTCTCGAGAGCTAGAACCACCACAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-224s1c1
Sequence:CCGGCCAGCTGCTGTAGGCCCAGTTCTCGAGAACTGGGCCTACAGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029613
KRTAP4-7 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-764s21c1
Sequence:CCGGCACCAGCTGCTGAATTGAATCCTCGAGGATTCAATTCAGCAGCTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-630s21c1
Sequence:CCGGTCATATCGATGGATGTTGTTTCTCGAGAAACAACATCCATCGATATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029613.1-688s21c1
Sequence:CCGGATGGCTATTCTAGCTTCAATCCTCGAGGATTGAAGCTAGAATAGCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029613.1-652s1c1
Sequence:CCGGGCTGAGTAACATCTCTATATTCTCGAGAATATAGAGATGTTACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-370s1c1
Sequence:CCGGCAACCATCTTGTGGTGGTTCTCTCGAGAGAACCACCACAAGATGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-368s1c1
Sequence:CCGGGCCAACCATCTTGTGGTGGTTCTCGAGAACCACCACAAGATGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-374s1c1
Sequence:CCGGCATCTTGTGGTGGTTCTAGCTCTCGAGAGCTAGAACCACCACAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029613.1-224s1c1
Sequence:CCGGCCAGCTGCTGTAGGCCCAGTTCTCGAGAACTGGGCCTACAGCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)