EMAIL THIS PAGE TO A FRIEND

KRTAP4-8

keratin associated protein 4-8

4 Gene Product Result for
Synonyms: KAP4.8 KRTAP4.8
UniProtKB ID: Q9BYQ9, A8MSH3
Gene ID:
Mouse(665992) keratin associated protein 4-8
Rat(100910690) keratin associated protein 4-8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_002347748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_002347748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_002347748 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_002347748
KRTAP4-8 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-841s21c1
Sequence:CCGGGTAATCCACTAGCTAAGAAATCTCGAGATTTCTTAGCTAGTGGATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-761s21c1
Sequence:CCGGTGAGAACATTCTGGTTCATTTCTCGAGAAATGAACCAGAATGTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-818s21c1
Sequence:CCGGTGGCACCAAATACGAATTAATCTCGAGATTAATTCGTATTTGGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-708s21c1
Sequence:CCGGAGCAGGGTGGACCTCATGTATCTCGAGATACATGAGGTCCACCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-642s21c1
Sequence:CCGGTCCACAAATGTAGACCATTCTCTCGAGAGAATGGTCTACATTTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_002347748
KRTAP4-8 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-841s21c1
Sequence:CCGGGTAATCCACTAGCTAAGAAATCTCGAGATTTCTTAGCTAGTGGATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-761s21c1
Sequence:CCGGTGAGAACATTCTGGTTCATTTCTCGAGAAATGAACCAGAATGTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-818s21c1
Sequence:CCGGTGGCACCAAATACGAATTAATCTCGAGATTAATTCGTATTTGGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-708s21c1
Sequence:CCGGAGCAGGGTGGACCTCATGTATCTCGAGATACATGAGGTCCACCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-642s21c1
Sequence:CCGGTCCACAAATGTAGACCATTCTCTCGAGAGAATGGTCTACATTTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_002347748
KRTAP4-8 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-841s21c1
Sequence:CCGGGTAATCCACTAGCTAAGAAATCTCGAGATTTCTTAGCTAGTGGATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-761s21c1
Sequence:CCGGTGAGAACATTCTGGTTCATTTCTCGAGAAATGAACCAGAATGTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-818s21c1
Sequence:CCGGTGGCACCAAATACGAATTAATCTCGAGATTAATTCGTATTTGGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-708s21c1
Sequence:CCGGAGCAGGGTGGACCTCATGTATCTCGAGATACATGAGGTCCACCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_002347748.1-642s21c1
Sequence:CCGGTCCACAAATGTAGACCATTCTCTCGAGAGAATGGTCTACATTTGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085547
KRTAP4-8 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-432s21c1
Sequence:CCGGTAGTTCTAGCTGTTGTGGATCCTCGAGGATCCACAACAGCTAGAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-419s21c1
Sequence:CCGGGTCCCTGCTGTGGTAGTTCTACTCGAGTAGAACTACCACAGCAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-261s21c1
Sequence:CCGGTCAGTGCTGCCAGTCTGTGTGCTCGAGCACACAGACTGGCAGCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-316s21c1
Sequence:CCGGATTTCCAGCTGCTGCAGACCTCTCGAGAGGTCTGCAGCAGCTGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-188s21c1
Sequence:CCGGGCTGTTGCATTTCTAGCTGCTCTCGAGAGCAGCTAGAAATGCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085547
KRTAP4-8 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-432s21c1
Sequence:CCGGTAGTTCTAGCTGTTGTGGATCCTCGAGGATCCACAACAGCTAGAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-419s21c1
Sequence:CCGGGTCCCTGCTGTGGTAGTTCTACTCGAGTAGAACTACCACAGCAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-261s21c1
Sequence:CCGGTCAGTGCTGCCAGTCTGTGTGCTCGAGCACACAGACTGGCAGCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-316s21c1
Sequence:CCGGATTTCCAGCTGCTGCAGACCTCTCGAGAGGTCTGCAGCAGCTGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-188s21c1
Sequence:CCGGGCTGTTGCATTTCTAGCTGCTCTCGAGAGCAGCTAGAAATGCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085547
KRTAP4-8 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-432s21c1
Sequence:CCGGTAGTTCTAGCTGTTGTGGATCCTCGAGGATCCACAACAGCTAGAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-419s21c1
Sequence:CCGGGTCCCTGCTGTGGTAGTTCTACTCGAGTAGAACTACCACAGCAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-261s21c1
Sequence:CCGGTCAGTGCTGCCAGTCTGTGTGCTCGAGCACACAGACTGGCAGCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-316s21c1
Sequence:CCGGATTTCCAGCTGCTGCAGACCTCTCGAGAGGTCTGCAGCAGCTGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085547.2-188s21c1
Sequence:CCGGGCTGTTGCATTTCTAGCTGCTCTCGAGAGCAGCTAGAAATGCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)