EMAIL THIS PAGE TO A FRIEND

KRTAP4-9

keratin associated protein 4-9

29 Gene Product Result for
Synonyms: KAP4.9
UniProtKB ID: Q9BYQ8
Gene ID:
Mouse(665998) keratin associated protein 4-9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146041 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718442 Rosetta Predictions human pricing
NM_001085548 Rosetta Predictions mouse pricing
XM_980798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00423941 predicted 849
2 SASI_Hs02_00423942 predicted 852
3 SASI_Hs02_00423943 predicted 761
4 SASI_Hs02_00423944 predicted 717
5 SASI_Hs02_00423945 predicted 709
6 SASI_Hs02_00423946 predicted 978
7 SASI_Hs02_00423947 predicted 920
8 SASI_Hs02_00423948 predicted 979
9 SASI_Hs02_00423949 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300959 predicted 876
2 SASI_Mm02_00300960 predicted 822
3 SASI_Mm02_00300961 predicted 906
4 SASI_Mm02_00300962 predicted 774
5 SASI_Mm02_00300963 predicted 918
6 SASI_Mm02_00300964 predicted 805
7 SASI_Mm02_00300965 predicted 740
8 SASI_Mm02_00300966 predicted 927
9 SASI_Mm02_00300967 predicted 897
10 SASI_Mm02_00300968 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210823 predicted 236
2 SASI_Mm01_00210824 predicted 245
3 SASI_Mm01_00210825 predicted 702
4 SASI_Mm01_00210826 predicted 711
5 SASI_Mm01_00210827 predicted 688
6 SASI_Mm01_00210828 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146041
KRTAP4-9 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-790s21c1
Sequence:CCGGTGAGAACATTCTGATTCATTTCTCGAGAAATGAATCAGAATGTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-738s21c1
Sequence:CCGGATAGAATGGAACTCATGTTTCCTCGAGGAAACATGAGTTCCATTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-847s21c1
Sequence:CCGGTGGCACCAAATGTGAATTAATCTCGAGATTAATTCACATTTGGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-869s21c1
Sequence:CCGGTGTAATCCACTAGCTAGAAATCTCGAGATTTCTAGCTAGTGGATTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-925s21c1
Sequence:CCGGACTTTGAGGTACAGATCTTCTCTCGAGAGAAGATCTGTACCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146041
KRTAP4-9 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-790s21c1
Sequence:CCGGTGAGAACATTCTGATTCATTTCTCGAGAAATGAATCAGAATGTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-738s21c1
Sequence:CCGGATAGAATGGAACTCATGTTTCCTCGAGGAAACATGAGTTCCATTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-847s21c1
Sequence:CCGGTGGCACCAAATGTGAATTAATCTCGAGATTAATTCACATTTGGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-869s21c1
Sequence:CCGGTGTAATCCACTAGCTAGAAATCTCGAGATTTCTAGCTAGTGGATTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-925s21c1
Sequence:CCGGACTTTGAGGTACAGATCTTCTCTCGAGAGAAGATCTGTACCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146041
KRTAP4-9 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-790s21c1
Sequence:CCGGTGAGAACATTCTGATTCATTTCTCGAGAAATGAATCAGAATGTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-738s21c1
Sequence:CCGGATAGAATGGAACTCATGTTTCCTCGAGGAAACATGAGTTCCATTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-847s21c1
Sequence:CCGGTGGCACCAAATGTGAATTAATCTCGAGATTAATTCACATTTGGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-869s21c1
Sequence:CCGGTGTAATCCACTAGCTAGAAATCTCGAGATTTCTAGCTAGTGGATTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146041.1-925s21c1
Sequence:CCGGACTTTGAGGTACAGATCTTCTCTCGAGAGAAGATCTGTACCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085548
KRTAP4-9 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-800s21c1
Sequence:CCGGCCCACAGTGTCCTGTTCTTCACTCGAGTGAAGAACAGGACACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-829s21c1
Sequence:CCGGCATTCCTGATGTAGACCATATCTCGAGATATGGTCTACATCAGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085548.2-777s21c1
Sequence:CCGGGTTCTTGCTGCTGAGGTTTCTCTCGAGAGAAACCTCAGCAGCAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-878s21c1
Sequence:CCGGAGCTTCTCTCTTAACATATTGCTCGAGCAATATGTTAAGAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-813s21c1
Sequence:CCGGGTTCTTCACCATCCAGCATTCCTCGAGGAATGCTGGATGGTGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085548
KRTAP4-9 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-800s21c1
Sequence:CCGGCCCACAGTGTCCTGTTCTTCACTCGAGTGAAGAACAGGACACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-829s21c1
Sequence:CCGGCATTCCTGATGTAGACCATATCTCGAGATATGGTCTACATCAGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085548.2-777s21c1
Sequence:CCGGGTTCTTGCTGCTGAGGTTTCTCTCGAGAGAAACCTCAGCAGCAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-878s21c1
Sequence:CCGGAGCTTCTCTCTTAACATATTGCTCGAGCAATATGTTAAGAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-813s21c1
Sequence:CCGGGTTCTTCACCATCCAGCATTCCTCGAGGAATGCTGGATGGTGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085548
KRTAP4-9 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-800s21c1
Sequence:CCGGCCCACAGTGTCCTGTTCTTCACTCGAGTGAAGAACAGGACACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-829s21c1
Sequence:CCGGCATTCCTGATGTAGACCATATCTCGAGATATGGTCTACATCAGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085548.2-777s21c1
Sequence:CCGGGTTCTTGCTGCTGAGGTTTCTCTCGAGAGAAACCTCAGCAGCAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-878s21c1
Sequence:CCGGAGCTTCTCTCTTAACATATTGCTCGAGCAATATGTTAAGAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085548.2-813s21c1
Sequence:CCGGGTTCTTCACCATCCAGCATTCCTCGAGGAATGCTGGATGGTGAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)