EMAIL THIS PAGE TO A FRIEND

KRTAP5-10

keratin associated protein 5-10

13 Gene Product Result for
Synonyms: KRTAP5.10
Species: Human KRTAP5-10(387273)
UniProtKB ID: Q6L8G5, B9EHA4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012710 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159633 predicted 804
2 SASI_Hs01_00159634 predicted 813
3 SASI_Hs01_00159635 predicted 669
4 SASI_Hs01_00159636 predicted 965
5 SASI_Hs01_00159637 predicted 676
6 SASI_Hs02_00306216 predicted 966
7 SASI_Hs01_00159638 predicted 672
8 SASI_Hs02_00306217 predicted 959
9 SASI_Hs01_00159639 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012710
KRTAP5-10 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-683s21c1
Sequence:CCGGGTTATGATTTCCCTGAATTAACTCGAGTTAATTCAGGGAAATCATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-693s21c1
Sequence:CCGGCCCTGAATTAATTCATCCCACCTCGAGGTGGGATGAATTAATTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012710.1-648s1c1
Sequence:CCGGGACCTTCAGGTTTCACCTGTTCTCGAGAACAGGTGAAACCTGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-701s21c1
Sequence:CCGGTAATTCATCCCACGCATCCTCCTCGAGGAGGATGCGTGGGATGAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-806s21c1
Sequence:CCGGAGCCTCCTCACTCCGGAAATGCTCGAGCATTTCCGGAGTGAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-670s21c1
Sequence:CCGGGGTGAAAGCATTTGTTATGATCTCGAGATCATAACAAATGCTTTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012710
KRTAP5-10 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-683s21c1
Sequence:CCGGGTTATGATTTCCCTGAATTAACTCGAGTTAATTCAGGGAAATCATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-693s21c1
Sequence:CCGGCCCTGAATTAATTCATCCCACCTCGAGGTGGGATGAATTAATTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012710.1-648s1c1
Sequence:CCGGGACCTTCAGGTTTCACCTGTTCTCGAGAACAGGTGAAACCTGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-701s21c1
Sequence:CCGGTAATTCATCCCACGCATCCTCCTCGAGGAGGATGCGTGGGATGAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-806s21c1
Sequence:CCGGAGCCTCCTCACTCCGGAAATGCTCGAGCATTTCCGGAGTGAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-670s21c1
Sequence:CCGGGGTGAAAGCATTTGTTATGATCTCGAGATCATAACAAATGCTTTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012710
KRTAP5-10 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-683s21c1
Sequence:CCGGGTTATGATTTCCCTGAATTAACTCGAGTTAATTCAGGGAAATCATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-693s21c1
Sequence:CCGGCCCTGAATTAATTCATCCCACCTCGAGGTGGGATGAATTAATTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012710.1-648s1c1
Sequence:CCGGGACCTTCAGGTTTCACCTGTTCTCGAGAACAGGTGAAACCTGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-701s21c1
Sequence:CCGGTAATTCATCCCACGCATCCTCCTCGAGGAGGATGCGTGGGATGAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-806s21c1
Sequence:CCGGAGCCTCCTCACTCCGGAAATGCTCGAGCATTTCCGGAGTGAGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012710.1-670s21c1
Sequence:CCGGGGTGAAAGCATTTGTTATGATCTCGAGATCATAACAAATGCTTTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)