EMAIL THIS PAGE TO A FRIEND

KRTAP5-11

keratin associated protein 5-11

17 Gene Product Result for
Synonyms: KRTAP5-5 KRTAP5-6 KRTAP5.11
Species: Human KRTAP5-11(440051)
UniProtKB ID: Q6L8G4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005405 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005405 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031549 predicted 674
2 SASI_Hs02_00304893 predicted 729
3 SASI_Hs01_00031552 predicted 694
4 SASI_Hs01_00031554 predicted 716
5 SASI_Hs02_00304894 predicted 713
6 SASI_Hs01_00031550 predicted 640
7 SASI_Hs01_00031551 predicted 820
8 SASI_Hs01_00031553 predicted 825
9 SASI_Hs01_00031555 predicted 150
10 SASI_Hs01_00031557 predicted 585
11 SASI_Hs01_00031556 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005405
KRTAP5-11 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-11
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-137s21c1
Sequence:CCGGCAGCTGCTGTGTGCCCATTTGCTCGAGCAAATGGGCACACAGCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005405.2-680s21c1
Sequence:CCGGAGCTTCCTCACTCCGGAAACACTCGAGTGTTTCCGGAGTGAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-318s21c1
Sequence:CCGGTCCTCAGGCTGTGGGTCATTCCTCGAGGAATGACCCACAGCCTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-485s21c1
Sequence:CCGGCGTGTGCTGCCAGTGTAAGATCTCGAGATCTTACACTGGCAGCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-285s21c1
Sequence:CCGGTCCCAGTCCAACTGCTGTAAGCTCGAGCTTACAGCAGTTGGACTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005405.1-523s1c1
Sequence:CCGGGACCTTCAGGTTTCTCCTCTTCTCGAGAAGAGGAGAAACCTGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005405
KRTAP5-11 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-11
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-137s21c1
Sequence:CCGGCAGCTGCTGTGTGCCCATTTGCTCGAGCAAATGGGCACACAGCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005405.2-680s21c1
Sequence:CCGGAGCTTCCTCACTCCGGAAACACTCGAGTGTTTCCGGAGTGAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-318s21c1
Sequence:CCGGTCCTCAGGCTGTGGGTCATTCCTCGAGGAATGACCCACAGCCTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-485s21c1
Sequence:CCGGCGTGTGCTGCCAGTGTAAGATCTCGAGATCTTACACTGGCAGCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-285s21c1
Sequence:CCGGTCCCAGTCCAACTGCTGTAAGCTCGAGCTTACAGCAGTTGGACTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005405.1-523s1c1
Sequence:CCGGGACCTTCAGGTTTCTCCTCTTCTCGAGAAGAGGAGAAACCTGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005405
KRTAP5-11 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-11
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-137s21c1
Sequence:CCGGCAGCTGCTGTGTGCCCATTTGCTCGAGCAAATGGGCACACAGCAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005405.2-680s21c1
Sequence:CCGGAGCTTCCTCACTCCGGAAACACTCGAGTGTTTCCGGAGTGAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-318s21c1
Sequence:CCGGTCCTCAGGCTGTGGGTCATTCCTCGAGGAATGACCCACAGCCTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-485s21c1
Sequence:CCGGCGTGTGCTGCCAGTGTAAGATCTCGAGATCTTACACTGGCAGCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005405.2-285s21c1
Sequence:CCGGTCCCAGTCCAACTGCTGTAAGCTCGAGCTTACAGCAGTTGGACTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005405.1-523s1c1
Sequence:CCGGGACCTTCAGGTTTCTCCTCTTCTCGAGAAGAGGAGAAACCTGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)