EMAIL THIS PAGE TO A FRIEND

KRTAP5-2

keratin associated protein 5-2

30 Gene Product Result for
Synonyms: KRTAP5-8 KRTAP5.2
UniProtKB ID: Q701N4, A9JTZ1
Gene ID:
Mouse(71623) keratin associated protein 5-2
Rat(685377) keratin associated protein 5-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004325 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004325 Rosetta Predictions human pricing
XM_001063548 Rosetta Predictions rat pricing
NM_027844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032629 predicted 770
2 SASI_Hs01_00032630 predicted 742
3 SASI_Hs01_00032631 predicted 619
4 SASI_Hs01_00032632 predicted 624
5 SASI_Hs01_00032633 predicted 636
6 SASI_Hs01_00032635 predicted 763
7 SASI_Hs01_00032634 predicted 825
8 SASI_Hs01_00032636 predicted 913
9 SASI_Hs01_00032637 predicted 202
10 SASI_Hs01_00032638 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307522 predicted 413
2 SASI_Rn02_00307523 predicted 604
3 SASI_Rn02_00307524 predicted 425
4 SASI_Rn02_00307525 predicted 607
5 SASI_Rn02_00307526 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022074 predicted 702
2 SASI_Mm01_00022075 predicted 634
3 SASI_Mm01_00022076 predicted 649
4 SASI_Mm01_00022077 predicted 655
5 SASI_Mm01_00022078 predicted 646
6 SASI_Mm01_00022079 predicted 627
7 SASI_Mm01_00022081 predicted 638
8 SASI_Mm01_00022082 predicted 615
9 SASI_Mm01_00022083 predicted 693
10 SASI_Mm02_00332807 predicted 633
11 SASI_Mm01_00022080 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027844
KRTAP5-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000098360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027844.1-642s1c1
Sequence:CCGGCCAAGAAGTACCTCTACTATTCTCGAGAATAGTAGAGGTACTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-608s1c1
Sequence:CCGGTCCTGTATGCTGCCAGTGTAACTCGAGTTACACTGGCAGCATACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-478s1c1
Sequence:CCGGGTTGTTGCCAATCCAGCTGTTCTCGAGAACAGCTGGATTGGCAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-469s1c1
Sequence:CCGGGCAAGCCCTGTTGTTGCCAATCTCGAGATTGGCAACAACAGGGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027844
KRTAP5-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000098360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027844.1-642s1c1
Sequence:CCGGCCAAGAAGTACCTCTACTATTCTCGAGAATAGTAGAGGTACTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-608s1c1
Sequence:CCGGTCCTGTATGCTGCCAGTGTAACTCGAGTTACACTGGCAGCATACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-478s1c1
Sequence:CCGGGTTGTTGCCAATCCAGCTGTTCTCGAGAACAGCTGGATTGGCAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-469s1c1
Sequence:CCGGGCAAGCCCTGTTGTTGCCAATCTCGAGATTGGCAACAACAGGGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027844
KRTAP5-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000098360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027844.1-642s1c1
Sequence:CCGGCCAAGAAGTACCTCTACTATTCTCGAGAATAGTAGAGGTACTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-608s1c1
Sequence:CCGGTCCTGTATGCTGCCAGTGTAACTCGAGTTACACTGGCAGCATACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-478s1c1
Sequence:CCGGGTTGTTGCCAATCCAGCTGTTCTCGAGAACAGCTGGATTGGCAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027844.1-469s1c1
Sequence:CCGGGCAAGCCCTGTTGTTGCCAATCTCGAGATTGGCAACAACAGGGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004325
KRTAP5-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004325.1-610s1c1
Sequence:CCGGGTTTGGTGAAAGCATTTCTTACTCGAGTAAGAAATGCTTTCACCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-205s1c1
Sequence:CCGGCCAGATGTTATGTGCCTGTCTCTCGAGAGACAGGCACATAACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-391s1c1
Sequence:CCGGCCAGCTGTTGTAAGCCCTGTTCTCGAGAACAGGGCTTACAACAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-551s1c1
Sequence:CCGGCCCTGTGTGCTGCCAGTGTAACTCGAGTTACACTGGCAGCACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-538s1c1
Sequence:CCGGCCAACTGTTGTGTCCCTGTGTCTCGAGACACAGGGACACAACAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004325
KRTAP5-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004325.1-610s1c1
Sequence:CCGGGTTTGGTGAAAGCATTTCTTACTCGAGTAAGAAATGCTTTCACCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-205s1c1
Sequence:CCGGCCAGATGTTATGTGCCTGTCTCTCGAGAGACAGGCACATAACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-391s1c1
Sequence:CCGGCCAGCTGTTGTAAGCCCTGTTCTCGAGAACAGGGCTTACAACAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-551s1c1
Sequence:CCGGCCCTGTGTGCTGCCAGTGTAACTCGAGTTACACTGGCAGCACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-538s1c1
Sequence:CCGGCCAACTGTTGTGTCCCTGTGTCTCGAGACACAGGGACACAACAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004325
KRTAP5-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004325.1-610s1c1
Sequence:CCGGGTTTGGTGAAAGCATTTCTTACTCGAGTAAGAAATGCTTTCACCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-205s1c1
Sequence:CCGGCCAGATGTTATGTGCCTGTCTCTCGAGAGACAGGCACATAACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-391s1c1
Sequence:CCGGCCAGCTGTTGTAAGCCCTGTTCTCGAGAACAGGGCTTACAACAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-551s1c1
Sequence:CCGGCCCTGTGTGCTGCCAGTGTAACTCGAGTTACACTGGCAGCACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004325.1-538s1c1
Sequence:CCGGCCAACTGTTGTGTCCCTGTGTCTCGAGACACAGGGACACAACAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)