EMAIL THIS PAGE TO A FRIEND

KRTAP5-3

keratin associated protein 5-3

15 Gene Product Result for
Synonyms: KRTAP5-9 KRTAP5.3
UniProtKB ID: Q6L8H2, Q6PL44, Q701N3
Gene ID:
Mouse(77215) keratin associated protein 5-3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012708 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012708 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306215 predicted 839
2 SASI_Hs01_00235041 predicted 796
3 SASI_Hs01_00235043 predicted 356
4 SASI_Hs01_00235044 predicted 811
5 SASI_Hs01_00235036 predicted 847
6 SASI_Hs01_00235037 predicted 794
7 SASI_Hs01_00235038 predicted 848
8 SASI_Hs01_00235039 predicted 173
9 SASI_Hs01_00235040 predicted 860
10 SASI_Hs01_00235042 predicted 176
11 SASI_Hs01_00235045 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012708
KRTAP5-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-456s21c1
Sequence:CCGGCTCCCAGTGCAGCTGCTATAACTCGAGTTATAGCAGCTGCACTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-186s21c1
Sequence:CCGGTGTACCTGTCTGCTGCTGCAACTCGAGTTGCAGCAGCAGACAGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-544s21c1
Sequence:CCGGTCCCAGTCCAGCTGCTGTAAGCTCGAGCTTACAGCAGCTGGACTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-640s21c1
Sequence:CCGGAGCTGCTGCAAACCCTGCTGTCTCGAGACAGCAGGGTTTGCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-573s21c1
Sequence:CCGGTTCCCAGTCCAGCTGCTGTAACTCGAGTTACAGCAGCTGGACTGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012708
KRTAP5-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-456s21c1
Sequence:CCGGCTCCCAGTGCAGCTGCTATAACTCGAGTTATAGCAGCTGCACTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-186s21c1
Sequence:CCGGTGTACCTGTCTGCTGCTGCAACTCGAGTTGCAGCAGCAGACAGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-544s21c1
Sequence:CCGGTCCCAGTCCAGCTGCTGTAAGCTCGAGCTTACAGCAGCTGGACTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-640s21c1
Sequence:CCGGAGCTGCTGCAAACCCTGCTGTCTCGAGACAGCAGGGTTTGCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-573s21c1
Sequence:CCGGTTCCCAGTCCAGCTGCTGTAACTCGAGTTACAGCAGCTGGACTGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012708
KRTAP5-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-456s21c1
Sequence:CCGGCTCCCAGTGCAGCTGCTATAACTCGAGTTATAGCAGCTGCACTGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-186s21c1
Sequence:CCGGTGTACCTGTCTGCTGCTGCAACTCGAGTTGCAGCAGCAGACAGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-544s21c1
Sequence:CCGGTCCCAGTCCAGCTGCTGTAAGCTCGAGCTTACAGCAGCTGGACTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-640s21c1
Sequence:CCGGAGCTGCTGCAAACCCTGCTGTCTCGAGACAGCAGGGTTTGCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012708.2-573s21c1
Sequence:CCGGTTCCCAGTCCAGCTGCTGTAACTCGAGTTACAGCAGCTGGACTGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)