EMAIL THIS PAGE TO A FRIEND

KRTAP5-4

keratin associated protein 5-4

32 Gene Product Result for
Synonyms: KRTAP5.4
UniProtKB ID: Q6L8H1
Gene ID:
Mouse(50775) keratin associated protein 5-4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012709 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012709 Rosetta Predictions human pricing
NM_015809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187566 predicted 1009
2 SASI_Hs01_00187567 predicted 1072
3 SASI_Hs01_00187568 predicted 938
4 SASI_Hs01_00187569 predicted 935
5 SASI_Hs01_00187570 predicted 1064
6 SASI_Hs01_00187571 predicted 1013
7 SASI_Hs01_00187572 predicted 1002
8 SASI_Hs01_00187573 predicted 938
9 SASI_Hs01_00187574 predicted 931
10 SASI_Hs01_00187575 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323192 predicted 802
2 SASI_Mm01_00169775 predicted 300
3 SASI_Mm02_00323193 predicted 785
4 SASI_Mm02_00323194 predicted 890
5 SASI_Mm02_00323195 predicted 955
6 SASI_Mm02_00323196 predicted 783
7 SASI_Mm02_00323197 predicted 756
8 SASI_Mm02_00323198 predicted 874
9 SASI_Mm02_00323199 predicted 897
10 SASI_Mm02_00323200 predicted 807
11 SASI_Mm01_00169776 predicted 212
12 SASI_Mm01_00169777 predicted 217
13 SASI_Mm01_00169778 predicted 215
14 SASI_Mm01_00169779 predicted 207
15 SASI_Mm01_00169780 predicted 219
16 SASI_Mm01_00169781 predicted 226
17 SASI_Mm01_00169782 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015809
KRTAP5-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015809.2-819s21c1
Sequence:CCGGCTGTCTATTCCTCTGTTCTGGCTCGAGCCAGAACAGAGGAATAGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015809.2-376s21c1
Sequence:CCGGTCTTCAGGCTGTGGGTCTTCTCTCGAGAGAAGACCCACAGCCTGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015809.2-763s21c1
Sequence:CCGGTGAGACTCTGGCCACAGATCTCTCGAGAGATCTGTGGCCAGAGTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-223s1c1
Sequence:CCGGTGTCAATCCAGTTGCTGTAAACTCGAGTTTACAGCAACTGGATTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-209s1c1
Sequence:CCGGGCAAGGGAGGCTGTTGTCAATCTCGAGATTGACAACAGCCTCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-515s1c1
Sequence:CCGGGCTGCTGTAAACCCTGCTGCTCTCGAGAGCAGCAGGGTTTACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-77s1c1
Sequence:CCGGGCTGCTGTGTGCCTGTCTGTTCTCGAGAACAGACAGGCACACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-216s1c1
Sequence:CCGGAGGCTGTTGTCAATCCAGTTGCTCGAGCAACTGGATTGACAACAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015809
KRTAP5-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015809.2-819s21c1
Sequence:CCGGCTGTCTATTCCTCTGTTCTGGCTCGAGCCAGAACAGAGGAATAGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015809.2-376s21c1
Sequence:CCGGTCTTCAGGCTGTGGGTCTTCTCTCGAGAGAAGACCCACAGCCTGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015809.2-763s21c1
Sequence:CCGGTGAGACTCTGGCCACAGATCTCTCGAGAGATCTGTGGCCAGAGTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-223s1c1
Sequence:CCGGTGTCAATCCAGTTGCTGTAAACTCGAGTTTACAGCAACTGGATTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-209s1c1
Sequence:CCGGGCAAGGGAGGCTGTTGTCAATCTCGAGATTGACAACAGCCTCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-515s1c1
Sequence:CCGGGCTGCTGTAAACCCTGCTGCTCTCGAGAGCAGCAGGGTTTACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-77s1c1
Sequence:CCGGGCTGCTGTGTGCCTGTCTGTTCTCGAGAACAGACAGGCACACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-216s1c1
Sequence:CCGGAGGCTGTTGTCAATCCAGTTGCTCGAGCAACTGGATTGACAACAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015809
KRTAP5-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015809.2-819s21c1
Sequence:CCGGCTGTCTATTCCTCTGTTCTGGCTCGAGCCAGAACAGAGGAATAGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015809.2-376s21c1
Sequence:CCGGTCTTCAGGCTGTGGGTCTTCTCTCGAGAGAAGACCCACAGCCTGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015809.2-763s21c1
Sequence:CCGGTGAGACTCTGGCCACAGATCTCTCGAGAGATCTGTGGCCAGAGTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-223s1c1
Sequence:CCGGTGTCAATCCAGTTGCTGTAAACTCGAGTTTACAGCAACTGGATTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-209s1c1
Sequence:CCGGGCAAGGGAGGCTGTTGTCAATCTCGAGATTGACAACAGCCTCCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-515s1c1
Sequence:CCGGGCTGCTGTAAACCCTGCTGCTCTCGAGAGCAGCAGGGTTTACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-77s1c1
Sequence:CCGGGCTGCTGTGTGCCTGTCTGTTCTCGAGAACAGACAGGCACACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015809.1-216s1c1
Sequence:CCGGAGGCTGTTGTCAATCCAGTTGCTCGAGCAACTGGATTGACAACAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012709
KRTAP5-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1051s1c1
Sequence:CCGGCCTAAGAAGAGTCCACCCTAACTCGAGTTAGGGTGGACTCTTCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-941s1c1
Sequence:CCGGCTGCTAATCCTGTCTTCCAAACTCGAGTTTGGAAGACAGGATTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165148    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-936s1c1
Sequence:CCGGGAGTCCTGCTAATCCTGTCTTCTCGAGAAGACAGGATTAGCAGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-928s1c1
Sequence:CCGGCCTCATGTGAGTCCTGCTAATCTCGAGATTAGCAGGACTCACATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1079s1c1
Sequence:CCGGCCATTGTCTCTCCTAACAAATCTCGAGATTTGTTAGGAGAGACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1080s1c1
Sequence:CCGGCATTGTCTCTCCTAACAAATTCTCGAGAATTTGTTAGGAGAGACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012709
KRTAP5-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1051s1c1
Sequence:CCGGCCTAAGAAGAGTCCACCCTAACTCGAGTTAGGGTGGACTCTTCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-941s1c1
Sequence:CCGGCTGCTAATCCTGTCTTCCAAACTCGAGTTTGGAAGACAGGATTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165148    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-936s1c1
Sequence:CCGGGAGTCCTGCTAATCCTGTCTTCTCGAGAAGACAGGATTAGCAGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-928s1c1
Sequence:CCGGCCTCATGTGAGTCCTGCTAATCTCGAGATTAGCAGGACTCACATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1079s1c1
Sequence:CCGGCCATTGTCTCTCCTAACAAATCTCGAGATTTGTTAGGAGAGACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1080s1c1
Sequence:CCGGCATTGTCTCTCCTAACAAATTCTCGAGAATTTGTTAGGAGAGACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012709
KRTAP5-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1051s1c1
Sequence:CCGGCCTAAGAAGAGTCCACCCTAACTCGAGTTAGGGTGGACTCTTCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-941s1c1
Sequence:CCGGCTGCTAATCCTGTCTTCCAAACTCGAGTTTGGAAGACAGGATTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165148    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-936s1c1
Sequence:CCGGGAGTCCTGCTAATCCTGTCTTCTCGAGAAGACAGGATTAGCAGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-928s1c1
Sequence:CCGGCCTCATGTGAGTCCTGCTAATCTCGAGATTAGCAGGACTCACATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1079s1c1
Sequence:CCGGCCATTGTCTCTCCTAACAAATCTCGAGATTTGTTAGGAGAGACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012709.1-1080s1c1
Sequence:CCGGCATTGTCTCTCCTAACAAATTCTCGAGAATTTGTTAGGAGAGACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)