EMAIL THIS PAGE TO A FRIEND

KRTAP5-5

keratin associated protein 5-5

27 Gene Product Result for
Synonyms: KRTAP5-11 KRTAP5.5
UniProtKB ID: Q701N2, A8MWN2
Gene ID:
Mouse(114666) keratin associated protein 5-5
Rat(685436) keratin associated protein 5-5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001480 Rosetta Predictions human pricing
XM_001063784 Rosetta Predictions rat pricing
NM_001037822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303777 predicted 868
2 SASI_Hs02_00303778 predicted 867
3 SASI_Hs02_00303779 predicted 765
4 SASI_Hs02_00303780 predicted 866
5 SASI_Hs02_00303781 predicted 763
6 SASI_Hs02_00303782 predicted 796
7 SASI_Hs02_00303783 predicted 797
8 SASI_Hs02_00303784 predicted 752
9 SASI_Hs02_00303785 predicted 812
10 SASI_Hs02_00303786 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308296 predicted 840
2 SASI_Rn02_00308297 predicted 840
3 SASI_Rn02_00308298 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289450 predicted 963
2 SASI_Mm02_00289451 predicted 425
3 SASI_Mm02_00289452 predicted 803
4 SASI_Mm02_00289453 predicted 789
5 SASI_Mm02_00289454 predicted 800
6 SASI_Mm02_00289455 predicted 825
7 SASI_Mm02_00289456 predicted 791
8 SASI_Mm02_00289457 predicted 413
9 SASI_Mm02_00289458 predicted 966
10 SASI_Mm02_00289459 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037822
KRTAP5-5 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000347319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-861s21c1
Sequence:CCGGAGGTTCTCTCCTGGGTCTTTACTCGAGTAAAGACCCAGGAGAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037822.1-773s21c1
Sequence:CCGGAGTGCAAGATCTGAGGTTTACCTCGAGGTAAACCTCAGATCTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-972s21c1
Sequence:CCGGCACACTCAGTGGATCAGATCTCTCGAGAGATCTGATCCACTGAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-827s21c1
Sequence:CCGGCTCTCTCCAGACAGGGATAAGCTCGAGCTTATCCCTGTCTGGAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037822
KRTAP5-5 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000347319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-861s21c1
Sequence:CCGGAGGTTCTCTCCTGGGTCTTTACTCGAGTAAAGACCCAGGAGAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037822.1-773s21c1
Sequence:CCGGAGTGCAAGATCTGAGGTTTACCTCGAGGTAAACCTCAGATCTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-972s21c1
Sequence:CCGGCACACTCAGTGGATCAGATCTCTCGAGAGATCTGATCCACTGAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-827s21c1
Sequence:CCGGCTCTCTCCAGACAGGGATAAGCTCGAGCTTATCCCTGTCTGGAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037822
KRTAP5-5 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000347319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-861s21c1
Sequence:CCGGAGGTTCTCTCCTGGGTCTTTACTCGAGTAAAGACCCAGGAGAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037822.1-773s21c1
Sequence:CCGGAGTGCAAGATCTGAGGTTTACCTCGAGGTAAACCTCAGATCTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-972s21c1
Sequence:CCGGCACACTCAGTGGATCAGATCTCTCGAGAGATCTGATCCACTGAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037822.1-827s21c1
Sequence:CCGGCTCTCTCCAGACAGGGATAAGCTCGAGCTTATCCCTGTCTGGAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001480
KRTAP5-5 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-564s21c1
Sequence:CCGGTCCAGCTGCTGTAAGCCTTACCTCGAGGTAAGGCTTACAGCAGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-662s21c1
Sequence:CCGGTGGATCATCCTGCTGCCAATCCTCGAGGATTGGCAGCAGGATGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001480.2-944s21c1
Sequence:CCGGCTCCCTGCTCCTCACTCATTTCTCGAGAAATGAGTGAGGAGCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-633s21c1
Sequence:CCGGTGTAAGCCCTGTAGCTGCTTCCTCGAGGAAGCAGCTACAGGGCTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-588s21c1
Sequence:CCGGTGCCAGTCCAGCTGCTGTAAGCTCGAGCTTACAGCAGCTGGACTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001480
KRTAP5-5 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-564s21c1
Sequence:CCGGTCCAGCTGCTGTAAGCCTTACCTCGAGGTAAGGCTTACAGCAGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-662s21c1
Sequence:CCGGTGGATCATCCTGCTGCCAATCCTCGAGGATTGGCAGCAGGATGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001480.2-944s21c1
Sequence:CCGGCTCCCTGCTCCTCACTCATTTCTCGAGAAATGAGTGAGGAGCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-633s21c1
Sequence:CCGGTGTAAGCCCTGTAGCTGCTTCCTCGAGGAAGCAGCTACAGGGCTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-588s21c1
Sequence:CCGGTGCCAGTCCAGCTGCTGTAAGCTCGAGCTTACAGCAGCTGGACTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001480
KRTAP5-5 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-564s21c1
Sequence:CCGGTCCAGCTGCTGTAAGCCTTACCTCGAGGTAAGGCTTACAGCAGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-662s21c1
Sequence:CCGGTGGATCATCCTGCTGCCAATCCTCGAGGATTGGCAGCAGGATGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001480.2-944s21c1
Sequence:CCGGCTCCCTGCTCCTCACTCATTTCTCGAGAAATGAGTGAGGAGCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-633s21c1
Sequence:CCGGTGTAAGCCCTGTAGCTGCTTCCTCGAGGAAGCAGCTACAGGGCTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001480.2-588s21c1
Sequence:CCGGTGCCAGTCCAGCTGCTGTAAGCTCGAGCTTACAGCAGCTGGACTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)