EMAIL THIS PAGE TO A FRIEND

KRTAP5-6

keratin associated protein 5-6

10 Gene Product Result for
Synonyms: KRTAP5.6
UniProtKB ID: Q6L8G9, A1L452
Gene ID:
cow(789858) keratin associated protein 5-6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012416 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306116 predicted 442
2 SASI_Hs02_00306117 predicted 433
3 SASI_Hs02_00306118 predicted 469
4 SASI_Hs02_00306119 predicted 485
5 SASI_Hs02_00306120 predicted 455
6 SASI_Hs02_00306121 predicted 483
7 SASI_Hs02_00306122 predicted 499
8 SASI_Hs02_00306123 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012416
KRTAP5-6 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-320s21c1
Sequence:CCGGGCTGCAAGCCCTGCTACTGTTCTCGAGAACAGTAGCAGGGCTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-331s21c1
Sequence:CCGGTGCTACTGTTCCTCAGGCTGTCTCGAGACAGCCTGAGGAACAGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-190s21c1
Sequence:CCGGTGCACCAGCTGTGGCTCTTGTCTCGAGACAAGAGCCACAGCTGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-138s21c1
Sequence:CCGGTGTGCCCATCTGCTGCTGCAACTCGAGTTGCAGCAGCAGATGGGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-307s21c1
Sequence:CCGGTCCCAGTGCAGTTGCTGCAAGCTCGAGCTTGCAGCAACTGCACTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012416
KRTAP5-6 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-320s21c1
Sequence:CCGGGCTGCAAGCCCTGCTACTGTTCTCGAGAACAGTAGCAGGGCTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-331s21c1
Sequence:CCGGTGCTACTGTTCCTCAGGCTGTCTCGAGACAGCCTGAGGAACAGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-190s21c1
Sequence:CCGGTGCACCAGCTGTGGCTCTTGTCTCGAGACAAGAGCCACAGCTGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-138s21c1
Sequence:CCGGTGTGCCCATCTGCTGCTGCAACTCGAGTTGCAGCAGCAGATGGGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-307s21c1
Sequence:CCGGTCCCAGTGCAGTTGCTGCAAGCTCGAGCTTGCAGCAACTGCACTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012416
KRTAP5-6 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-320s21c1
Sequence:CCGGGCTGCAAGCCCTGCTACTGTTCTCGAGAACAGTAGCAGGGCTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-331s21c1
Sequence:CCGGTGCTACTGTTCCTCAGGCTGTCTCGAGACAGCCTGAGGAACAGTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-190s21c1
Sequence:CCGGTGCACCAGCTGTGGCTCTTGTCTCGAGACAAGAGCCACAGCTGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-138s21c1
Sequence:CCGGTGTGCCCATCTGCTGCTGCAACTCGAGTTGCAGCAGCAGATGGGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012416.1-307s21c1
Sequence:CCGGTCCCAGTGCAGTTGCTGCAAGCTCGAGCTTGCAGCAACTGCACTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)