EMAIL THIS PAGE TO A FRIEND

KRTAP5-7

keratin associated protein 5-7

17 Gene Product Result for
Synonyms: KRTAP5-3 KRTAP5.7
Species: Human KRTAP5-7(440050)
UniProtKB ID: Q6L8G8, B2RNM3, Q701N5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012503 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225501 MISSION® esiRNA esiRNA targeting human KRTAP5-7 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012503 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011508 predicted 620
2 SASI_Hs01_00011509 predicted 766
3 SASI_Hs01_00011510 predicted 620
4 SASI_Hs01_00011511 predicted 768
5 SASI_Hs01_00011512 predicted 765
6 SASI_Hs01_00011513 predicted 631
7 SASI_Hs01_00011514 predicted 695
8 SASI_Hs01_00011515 predicted 846
9 SASI_Hs01_00011516 predicted 693
10 SASI_Hs01_00011517 predicted 690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012503
KRTAP5-7 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-547s1c1
Sequence:CCGGGTCTCATGTGAGTCCTGCTAACTCGAGTTAGCAGGACTCACATGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-630s1c1
Sequence:CCGGCATTCCTCACTATAAGATGAACTCGAGTTCATCTTATAGTGAGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-623s1c1
Sequence:CCGGCAGGGTCCATTCCTCACTATACTCGAGTATAGTGAGGAATGGACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-708s1c1
Sequence:CCGGCCTAACAAATTCTCTTCCCAACTCGAGTTGGGAAGAGAATTTGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-713s1c1
Sequence:CCGGCAAATTCTCTTCCCAAGTCAACTCGAGTTGACTTGGGAAGAGAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-672s1c1
Sequence:CCGGCTAAGGAGAGTCCACCCTAATCTCGAGATTAGGGTGGACTCTCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-637s1c1
Sequence:CCGGCACTATAAGATGAAGCCATATCTCGAGATATGGCTTCATCTTATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012503
KRTAP5-7 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-547s1c1
Sequence:CCGGGTCTCATGTGAGTCCTGCTAACTCGAGTTAGCAGGACTCACATGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-630s1c1
Sequence:CCGGCATTCCTCACTATAAGATGAACTCGAGTTCATCTTATAGTGAGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-623s1c1
Sequence:CCGGCAGGGTCCATTCCTCACTATACTCGAGTATAGTGAGGAATGGACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-708s1c1
Sequence:CCGGCCTAACAAATTCTCTTCCCAACTCGAGTTGGGAAGAGAATTTGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-713s1c1
Sequence:CCGGCAAATTCTCTTCCCAAGTCAACTCGAGTTGACTTGGGAAGAGAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-672s1c1
Sequence:CCGGCTAAGGAGAGTCCACCCTAATCTCGAGATTAGGGTGGACTCTCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-637s1c1
Sequence:CCGGCACTATAAGATGAAGCCATATCTCGAGATATGGCTTCATCTTATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012503
KRTAP5-7 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-547s1c1
Sequence:CCGGGTCTCATGTGAGTCCTGCTAACTCGAGTTAGCAGGACTCACATGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-630s1c1
Sequence:CCGGCATTCCTCACTATAAGATGAACTCGAGTTCATCTTATAGTGAGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-623s1c1
Sequence:CCGGCAGGGTCCATTCCTCACTATACTCGAGTATAGTGAGGAATGGACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-708s1c1
Sequence:CCGGCCTAACAAATTCTCTTCCCAACTCGAGTTGGGAAGAGAATTTGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-713s1c1
Sequence:CCGGCAAATTCTCTTCCCAAGTCAACTCGAGTTGACTTGGGAAGAGAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-672s1c1
Sequence:CCGGCTAAGGAGAGTCCACCCTAATCTCGAGATTAGGGTGGACTCTCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012503.1-637s1c1
Sequence:CCGGCACTATAAGATGAAGCCATATCTCGAGATATGGCTTCATCTTATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)