EMAIL THIS PAGE TO A FRIEND

KRTAP5-8

keratin associated protein 5-8

13 Gene Product Result for
Synonyms: KRTAP5-2 KRTAP5.8 UHSKerB
Species: Human KRTAP5-8(57830)
UniProtKB ID: O75690, Q6L8G7, Q6UTX6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021046 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021046 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354518 predicted 885
2 SASI_Hs02_00354519 predicted 767
3 SASI_Hs02_00354520 predicted 829
4 SASI_Hs02_00354521 predicted 681
5 SASI_Hs02_00354522 predicted 729
6 SASI_Hs02_00354523 predicted 679
7 SASI_Hs02_00354524 predicted 644
8 SASI_Hs02_00354525 predicted 808
9 SASI_Hs02_00354526 predicted 645
10 SASI_Hs02_00354527 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021046
KRTAP5-8 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-8
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-824s21c1
Sequence:CCGGACCTCATCACTTCAACCTTCTCTCGAGAGAAGGTTGAAGTGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-634s21c1
Sequence:CCGGGGCTCTCCAGGAATGACTGTACTCGAGTACAGTCATTCCTGGAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-1022s21c1
Sequence:CCGGCCTAGAGGACTCAGAATTATTCTCGAGAATAATTCTGAGTCCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021046.2-592s21c1
Sequence:CCGGCTGAGGCTCTGCCTACAAATCCTCGAGGATTTGTAGGCAGAGCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021046
KRTAP5-8 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-8
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-824s21c1
Sequence:CCGGACCTCATCACTTCAACCTTCTCTCGAGAGAAGGTTGAAGTGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-634s21c1
Sequence:CCGGGGCTCTCCAGGAATGACTGTACTCGAGTACAGTCATTCCTGGAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-1022s21c1
Sequence:CCGGCCTAGAGGACTCAGAATTATTCTCGAGAATAATTCTGAGTCCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021046.2-592s21c1
Sequence:CCGGCTGAGGCTCTGCCTACAAATCCTCGAGGATTTGTAGGCAGAGCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021046
KRTAP5-8 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-8
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-824s21c1
Sequence:CCGGACCTCATCACTTCAACCTTCTCTCGAGAGAAGGTTGAAGTGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-634s21c1
Sequence:CCGGGGCTCTCCAGGAATGACTGTACTCGAGTACAGTCATTCCTGGAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021046.2-1022s21c1
Sequence:CCGGCCTAGAGGACTCAGAATTATTCTCGAGAATAATTCTGAGTCCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021046.2-592s21c1
Sequence:CCGGCTGAGGCTCTGCCTACAAATCCTCGAGGATTTGTAGGCAGAGCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)