EMAIL THIS PAGE TO A FRIEND

KRTAP5-9

keratin associated protein 5-9

16 Gene Product Result for
Synonyms: KRN1 KRTAP5-1 KRTAP5.9
UniProtKB ID: P26371, Q14564, Q3MIP8
Gene ID:
cow(281265) keratin associated protein 5-9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005553 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005553 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177718 predicted 740
2 SASI_Hs01_00177725 predicted 896
3 SASI_Hs01_00177717 predicted 775
4 SASI_Hs01_00177719 predicted 716
5 SASI_Hs01_00177724 predicted 715
6 SASI_Hs01_00177726 predicted 842
7 SASI_Hs02_00339801 predicted 898
8 SASI_Hs02_00339802 predicted 770
9 SASI_Hs02_00339803 predicted 870
10 SASI_Hs02_00339804 predicted 884
11 SASI_Hs01_00177720 predicted 747
12 SASI_Hs01_00177721 predicted 804
13 SASI_Hs01_00177722 predicted 785
14 SASI_Hs01_00177723 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005553
KRTAP5-9 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-920s21c1
Sequence:CCGGATCCCAAGACCCAGGCAATTTCTCGAGAAATTGCCTGGGTCTTGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-895s21c1
Sequence:CCGGCTCCCTGCCCATTCCCTATAACTCGAGTTATAGGGAATGGGCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005553.3-737s21c1
Sequence:CCGGTGCAAGATCTGAGGCTCTAGTCTCGAGACTAGAGCCTCAGATCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-794s21c1
Sequence:CCGGCCAACAAGTGACTACCCTTGACTCGAGTCAAGGGTAGTCACTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-872s21c1
Sequence:CCGGCCCTGAGGAAATGGAATGAACCTCGAGGTTCATTCCATTTCCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005553
KRTAP5-9 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-920s21c1
Sequence:CCGGATCCCAAGACCCAGGCAATTTCTCGAGAAATTGCCTGGGTCTTGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-895s21c1
Sequence:CCGGCTCCCTGCCCATTCCCTATAACTCGAGTTATAGGGAATGGGCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005553.3-737s21c1
Sequence:CCGGTGCAAGATCTGAGGCTCTAGTCTCGAGACTAGAGCCTCAGATCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-794s21c1
Sequence:CCGGCCAACAAGTGACTACCCTTGACTCGAGTCAAGGGTAGTCACTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-872s21c1
Sequence:CCGGCCCTGAGGAAATGGAATGAACCTCGAGGTTCATTCCATTTCCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005553
KRTAP5-9 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-920s21c1
Sequence:CCGGATCCCAAGACCCAGGCAATTTCTCGAGAAATTGCCTGGGTCTTGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-895s21c1
Sequence:CCGGCTCCCTGCCCATTCCCTATAACTCGAGTTATAGGGAATGGGCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005553.3-737s21c1
Sequence:CCGGTGCAAGATCTGAGGCTCTAGTCTCGAGACTAGAGCCTCAGATCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-794s21c1
Sequence:CCGGCCAACAAGTGACTACCCTTGACTCGAGTCAAGGGTAGTCACTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005553.3-872s21c1
Sequence:CCGGCCCTGAGGAAATGGAATGAACCTCGAGGTTCATTCCATTTCCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)