EMAIL THIS PAGE TO A FRIEND

KRTAP6-1

keratin associated protein 6-1

24 Gene Product Result for
Synonyms: C21orf103 KAP6.1
UniProtKB ID: Q3LI64
Gene ID:
Mouse(16700) keratin associated protein 6-1
sheep(100499198) keratin associated protein 6-1
Domestic Rabbit(100328943) keratin associated protein 6-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181602 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181602 Rosetta Predictions human pricing
NM_010672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024410 predicted 155
2 SASI_Hs01_00024411 predicted 121
3 SASI_Hs01_00024412 predicted 150
4 SASI_Hs01_00024413 predicted 40
5 SASI_Hs01_00024414 predicted 156
6 SASI_Hs01_00024415 predicted 107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319102 predicted 506
2 SASI_Mm02_00319103 predicted 511
3 SASI_Mm01_00179046 predicted 293
4 SASI_Mm01_00179047 predicted 328
5 SASI_Mm01_00179048 predicted 278
6 SASI_Mm02_00319104 predicted 507
7 SASI_Mm01_00179050 predicted 486
8 SASI_Mm01_00179049 predicted 478
9 SASI_Mm02_00319105 predicted 382
10 SASI_Mm01_00179051 predicted 393
11 SASI_Mm01_00179045 predicted 376
12 SASI_Mm01_00179052 predicted 410
13 SASI_Mm01_00179053 predicted 467
14 SASI_Mm01_00179054 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010672
KRTAP6-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 6-1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-295s21c1
Sequence:CCGGAGTTCCTCTAACTGTAATTTCCTCGAGGAAATTACAGTTAGAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-324s21c1
Sequence:CCGGGCCATTCTTCACCTCATATATCTCGAGATATATGAGGTGAAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-423s21c1
Sequence:CCGGGTCTGATATGTCCAATCAATCCTCGAGGATTGATTGGACATATCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.2-302s1c1
Sequence:CCGGCTAACTGTAATTTCAGGACTTCTCGAGAAGTCCTGAAATTACAGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.3-423s1c1
Sequence:CCGGGTCTGATATGTCCAATCAATCCTCGAGGATTGATTGGACATATCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.3-324s1c1
Sequence:CCGGGCCATTCTTCACCTCATATATCTCGAGATATATGAGGTGAAGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-368s21c1
Sequence:CCGGGAACATCTACACCACAGATTTCTCGAGAAATCTGTGGTGTAGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010672.3-252s21c1
Sequence:CCGGATTGAAGACACCACGGTTCTTCTCGAGAAGAACCGTGGTGTCTTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.2-350s1c1
Sequence:CCGGGCCTTCTGCTTAGTTACTGAACTCGAGTTCAGTAACTAAGCAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010672
KRTAP6-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 6-1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-295s21c1
Sequence:CCGGAGTTCCTCTAACTGTAATTTCCTCGAGGAAATTACAGTTAGAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-324s21c1
Sequence:CCGGGCCATTCTTCACCTCATATATCTCGAGATATATGAGGTGAAGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-423s21c1
Sequence:CCGGGTCTGATATGTCCAATCAATCCTCGAGGATTGATTGGACATATCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.2-302s1c1
Sequence:CCGGCTAACTGTAATTTCAGGACTTCTCGAGAAGTCCTGAAATTACAGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.3-423s1c1
Sequence:CCGGGTCTGATATGTCCAATCAATCCTCGAGGATTGATTGGACATATCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.3-324s1c1
Sequence:CCGGGCCATTCTTCACCTCATATATCTCGAGATATATGAGGTGAAGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-368s21c1
Sequence:CCGGGAACATCTACACCACAGATTTCTCGAGAAATCTGTGGTGTAGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010672.3-252s21c1
Sequence:CCGGATTGAAGACACCACGGTTCTTCTCGAGAAGAACCGTGGTGTCTTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.2-350s1c1
Sequence:CCGGGCCTTCTGCTTAGTTACTGAACTCGAGTTCAGTAACTAAGCAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010672
KRTAP6-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 6-1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-295s21c1
Sequence:CCGGAGTTCCTCTAACTGTAATTTCCTCGAGGAAATTACAGTTAGAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-324s21c1
Sequence:CCGGGCCATTCTTCACCTCATATATCTCGAGATATATGAGGTGAAGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-423s21c1
Sequence:CCGGGTCTGATATGTCCAATCAATCCTCGAGGATTGATTGGACATATCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.2-302s1c1
Sequence:CCGGCTAACTGTAATTTCAGGACTTCTCGAGAAGTCCTGAAATTACAGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.3-423s1c1
Sequence:CCGGGTCTGATATGTCCAATCAATCCTCGAGGATTGATTGGACATATCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.3-324s1c1
Sequence:CCGGGCCATTCTTCACCTCATATATCTCGAGATATATGAGGTGAAGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010672.3-368s21c1
Sequence:CCGGGAACATCTACACCACAGATTTCTCGAGAAATCTGTGGTGTAGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010672.3-252s21c1
Sequence:CCGGATTGAAGACACCACGGTTCTTCTCGAGAAGAACCGTGGTGTCTTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010672.2-350s1c1
Sequence:CCGGGCCTTCTGCTTAGTTACTGAACTCGAGTTCAGTAACTAAGCAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181602
KRTAP6-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 6-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-192s21c1
Sequence:CCGGCTCTGGCTCTGGCTACTATTACTCGAGTAATAGTAGCCAGAGCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-134s21c1
Sequence:CCGGTGGGCTGTGGCTATGGCTATGCTCGAGCATAGCCATAGCCACAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-175s21c1
Sequence:CCGGTATGGCTATGGATGCGGCTCTCTCGAGAGAGCCGCATCCATAGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-163s21c1
Sequence:CCGGTCCCTCTGTGGCTATGGCTATCTCGAGATAGCCATAGCCACAGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-43s21c1
Sequence:CCGGTATGGGTTCTGTGGCTATGGACTCGAGTCCATAGCCACAGAACCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181602
KRTAP6-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 6-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-192s21c1
Sequence:CCGGCTCTGGCTCTGGCTACTATTACTCGAGTAATAGTAGCCAGAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-134s21c1
Sequence:CCGGTGGGCTGTGGCTATGGCTATGCTCGAGCATAGCCATAGCCACAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-175s21c1
Sequence:CCGGTATGGCTATGGATGCGGCTCTCTCGAGAGAGCCGCATCCATAGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-163s21c1
Sequence:CCGGTCCCTCTGTGGCTATGGCTATCTCGAGATAGCCATAGCCACAGAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-43s21c1
Sequence:CCGGTATGGGTTCTGTGGCTATGGACTCGAGTCCATAGCCACAGAACCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181602
KRTAP6-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 6-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-192s21c1
Sequence:CCGGCTCTGGCTCTGGCTACTATTACTCGAGTAATAGTAGCCAGAGCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-134s21c1
Sequence:CCGGTGGGCTGTGGCTATGGCTATGCTCGAGCATAGCCATAGCCACAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-175s21c1
Sequence:CCGGTATGGCTATGGATGCGGCTCTCTCGAGAGAGCCGCATCCATAGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-163s21c1
Sequence:CCGGTCCCTCTGTGGCTATGGCTATCTCGAGATAGCCATAGCCACAGAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181602.1-43s21c1
Sequence:CCGGTATGGGTTCTGTGGCTATGGACTCGAGTCCATAGCCACAGAACCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)