EMAIL THIS PAGE TO A FRIEND

KRTAP6-2

keratin associated protein 6-2

37 Gene Product Result for
Synonyms: KAP6.2
UniProtKB ID: Q3LI66
Gene ID:
Mouse(16701) keratin associated protein 6-2
Rat(498056) keratin associated protein 6-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125701 MISSION® esiRNA esiRNA human KRTAP6-2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181604 Rosetta Predictions human pricing
XM_001072481 Rosetta Predictions rat pricing
XM_579775 Rosetta Predictions rat pricing
NM_010673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233501 predicted 98
2 SASI_Hs01_00233502 predicted 73
3 SASI_Hs01_00233503 predicted 24
4 SASI_Hs01_00233504 predicted 130
5 SASI_Hs01_00233505 predicted 41
6 SASI_Hs01_00233506 predicted 108
7 SASI_Hs01_00233507 predicted 52
8 SASI_Hs01_00233508 predicted 53
9 SASI_Hs01_00233509 predicted 105
10 SASI_Hs01_00233510 predicted 73
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339338 predicted 285
2 SASI_Rn02_00339339 predicted 232
3 SASI_Rn02_00339340 predicted 334
4 SASI_Rn02_00339341 predicted 313
5 SASI_Rn02_00339342 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408668 predicted 289
2 SASI_Rn02_00408669 predicted 237
3 SASI_Rn02_00408670 predicted 332
4 SASI_Rn02_00408671 predicted 307
5 SASI_Rn02_00408672 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080945 predicted 474
2 SASI_Mm01_00080946 predicted 574
3 SASI_Mm01_00080947 predicted 504
4 SASI_Mm01_00080948 predicted 418
5 SASI_Mm01_00080949 predicted 515
6 SASI_Mm02_00319106 predicted 673
7 SASI_Mm02_00319107 predicted 713
8 SASI_Mm01_00080951 predicted 677
9 SASI_Mm01_00080952 predicted 521
10 SASI_Mm01_00080953 predicted 478
11 SASI_Mm01_00080950 predicted 610
12 SASI_Mm01_00080954 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010673
KRTAP6-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 6-2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010673.1-526s1c1
Sequence:CCGGGAGAGGATCAGTTGCTCCTAACTCGAGTTAGGAGCAACTGATCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-433s1c1
Sequence:CCGGCTGTGGATATGGCTCTTACTACTCGAGTAGTAAGAGCCATATCCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-438s1c1
Sequence:CCGGGATATGGCTCTTACTACAGATCTCGAGATCTGTAGTAAGAGCCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010673.1-582s1c1
Sequence:CCGGCCATGGCCAAGAGCTCTATATCTCGAGATATAGAGCTCTTGGCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-432s1c1
Sequence:CCGGGCTGTGGATATGGCTCTTACTCTCGAGAGTAAGAGCCATATCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010673.2-462s21c1
Sequence:CCGGACGGACCATCTTGCTACAGAACTCGAGTTCTGTAGCAAGATGGTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-586s21c1
Sequence:CCGGTATATCCAGGAAACTACAAATCTCGAGATTTGTAGTTTCCTGGATATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-526s21c1
Sequence:CCGGTGCTCCTAAACTGACACTTCTCTCGAGAGAAGTGTCAGTTTAGGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010673.2-482s21c1
Sequence:CCGGAGATGTTATTCTTGCTGTTAGCTCGAGCTAACAGCAAGAATAACATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-554s21c1
Sequence:CCGGATGCTTCTTTAAAGATCCATGCTCGAGCATGGATCTTTAAAGAAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010673
KRTAP6-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 6-2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010673.1-526s1c1
Sequence:CCGGGAGAGGATCAGTTGCTCCTAACTCGAGTTAGGAGCAACTGATCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-433s1c1
Sequence:CCGGCTGTGGATATGGCTCTTACTACTCGAGTAGTAAGAGCCATATCCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-438s1c1
Sequence:CCGGGATATGGCTCTTACTACAGATCTCGAGATCTGTAGTAAGAGCCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010673.1-582s1c1
Sequence:CCGGCCATGGCCAAGAGCTCTATATCTCGAGATATAGAGCTCTTGGCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-432s1c1
Sequence:CCGGGCTGTGGATATGGCTCTTACTCTCGAGAGTAAGAGCCATATCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010673.2-462s21c1
Sequence:CCGGACGGACCATCTTGCTACAGAACTCGAGTTCTGTAGCAAGATGGTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-586s21c1
Sequence:CCGGTATATCCAGGAAACTACAAATCTCGAGATTTGTAGTTTCCTGGATATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-526s21c1
Sequence:CCGGTGCTCCTAAACTGACACTTCTCTCGAGAGAAGTGTCAGTTTAGGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010673.2-482s21c1
Sequence:CCGGAGATGTTATTCTTGCTGTTAGCTCGAGCTAACAGCAAGAATAACATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-554s21c1
Sequence:CCGGATGCTTCTTTAAAGATCCATGCTCGAGCATGGATCTTTAAAGAAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010673
KRTAP6-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 6-2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010673.1-526s1c1
Sequence:CCGGGAGAGGATCAGTTGCTCCTAACTCGAGTTAGGAGCAACTGATCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-433s1c1
Sequence:CCGGCTGTGGATATGGCTCTTACTACTCGAGTAGTAAGAGCCATATCCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-438s1c1
Sequence:CCGGGATATGGCTCTTACTACAGATCTCGAGATCTGTAGTAAGAGCCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010673.1-582s1c1
Sequence:CCGGCCATGGCCAAGAGCTCTATATCTCGAGATATAGAGCTCTTGGCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010673.1-432s1c1
Sequence:CCGGGCTGTGGATATGGCTCTTACTCTCGAGAGTAAGAGCCATATCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010673.2-462s21c1
Sequence:CCGGACGGACCATCTTGCTACAGAACTCGAGTTCTGTAGCAAGATGGTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-586s21c1
Sequence:CCGGTATATCCAGGAAACTACAAATCTCGAGATTTGTAGTTTCCTGGATATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-526s21c1
Sequence:CCGGTGCTCCTAAACTGACACTTCTCTCGAGAGAAGTGTCAGTTTAGGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010673.2-482s21c1
Sequence:CCGGAGATGTTATTCTTGCTGTTAGCTCGAGCTAACAGCAAGAATAACATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010673.2-554s21c1
Sequence:CCGGATGCTTCTTTAAAGATCCATGCTCGAGCATGGATCTTTAAAGAAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)