EMAIL THIS PAGE TO A FRIEND

KRTAP6-3

keratin associated protein 6-3

25 Gene Product Result for
Synonyms: KAP6.3
UniProtKB ID: Q3LI67, A4IF26
Gene ID:
Mouse(100040249) keratin associated protein 6-3
cow(618362) keratin associated protein 6-3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181605 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181605 Rosetta Predictions human pricing
XM_001474351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065322 predicted 356
2 SASI_Hs01_00065323 predicted 349
3 SASI_Hs01_00065324 predicted 360
4 SASI_Hs01_00065325 predicted 317
5 SASI_Hs01_00065326 predicted 309
6 SASI_Hs01_00065327 predicted 344
7 SASI_Hs01_00065328 predicted 258
8 SASI_Hs01_00065329 predicted 361
9 SASI_Hs02_00370198 predicted 348
10 SASI_Hs02_00370199 predicted 378
11 SASI_Hs01_00065320 predicted 319
12 SASI_Hs01_00065321 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00374734 predicted 341
2 SASI_Mm02_00374735 predicted 876
3 SASI_Mm02_00374736 predicted 329
4 SASI_Mm02_00374737 predicted 803
5 SASI_Mm02_00374738 predicted 784
6 SASI_Mm02_00374739 predicted 297
7 SASI_Mm02_00374740 predicted 631
8 SASI_Mm02_00374741 predicted 842
9 SASI_Mm02_00374742 predicted 653
10 SASI_Mm02_00374743 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181605
KRTAP6-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 6-3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181605.3-329s21c1
Sequence:CCGGACTACTATTGAGGACACCATGCTCGAGCATGGTGTCCTCAATAGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181605.3-260s21c1
Sequence:CCGGGCTATGTCTCCCACTCCTTCTCTCGAGAGAAGGAGTGGGAGACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181605.2-440s1c1
Sequence:CCGGGCAGTGGAAGTCTAATATGATCTCGAGATCATATTAGACTTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-315s1c1
Sequence:CCGGCTCCAGCTTTGGCTACTACTACTCGAGTAGTAGTAGCCAAAGCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-35s1c1
Sequence:CCGGGCAGCTACTACAGAAACTACACTCGAGTGTAGTTTCTGTAGTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-317s1c1
Sequence:CCGGCCAGCTTTGGCTACTACTATTCTCGAGAATAGTAGTAGCCAAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-45s1c1
Sequence:CCGGCAGAAACTACAATGGTGGCCACTCGAGTGGCCACCATTGTAGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181605
KRTAP6-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 6-3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181605.3-329s21c1
Sequence:CCGGACTACTATTGAGGACACCATGCTCGAGCATGGTGTCCTCAATAGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181605.3-260s21c1
Sequence:CCGGGCTATGTCTCCCACTCCTTCTCTCGAGAGAAGGAGTGGGAGACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181605.2-440s1c1
Sequence:CCGGGCAGTGGAAGTCTAATATGATCTCGAGATCATATTAGACTTCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-315s1c1
Sequence:CCGGCTCCAGCTTTGGCTACTACTACTCGAGTAGTAGTAGCCAAAGCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-35s1c1
Sequence:CCGGGCAGCTACTACAGAAACTACACTCGAGTGTAGTTTCTGTAGTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-317s1c1
Sequence:CCGGCCAGCTTTGGCTACTACTATTCTCGAGAATAGTAGTAGCCAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-45s1c1
Sequence:CCGGCAGAAACTACAATGGTGGCCACTCGAGTGGCCACCATTGTAGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181605
KRTAP6-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 6-3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181605.3-329s21c1
Sequence:CCGGACTACTATTGAGGACACCATGCTCGAGCATGGTGTCCTCAATAGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181605.3-260s21c1
Sequence:CCGGGCTATGTCTCCCACTCCTTCTCTCGAGAGAAGGAGTGGGAGACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181605.2-440s1c1
Sequence:CCGGGCAGTGGAAGTCTAATATGATCTCGAGATCATATTAGACTTCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-315s1c1
Sequence:CCGGCTCCAGCTTTGGCTACTACTACTCGAGTAGTAGTAGCCAAAGCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-35s1c1
Sequence:CCGGGCAGCTACTACAGAAACTACACTCGAGTGTAGTTTCTGTAGTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-317s1c1
Sequence:CCGGCCAGCTTTGGCTACTACTATTCTCGAGAATAGTAGTAGCCAAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181605.2-45s1c1
Sequence:CCGGCAGAAACTACAATGGTGGCCACTCGAGTGGCCACCATTGTAGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)