EMAIL THIS PAGE TO A FRIEND

KRTAP7-1

keratin associated protein 7-1 (gene/pseudogene)

84 Gene Product Result for
Synonyms: KAP7.1
UniProtKB ID: Q8IUC3, Q3LI56
Gene ID:
Mouse(71363) keratin associated protein 7-1
Rat(363741) keratin associated protein 7-1
cow(100296254) keratin associated protein 7-1
dog(100687847) keratin associated protein 7-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181606 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724754 Rosetta Predictions human pricing
XM_927228 Rosetta Predictions human pricing
XM_941037 Rosetta Predictions human pricing
XM_001072629 Rosetta Predictions rat pricing
XM_344004 Rosetta Predictions rat pricing
XM_001474473 Rosetta Predictions mouse pricing
XM_001480709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00463454 predicted 379
2 SASI_Hs02_00463455 predicted 299
3 SASI_Hs02_00463456 predicted 390
4 SASI_Hs02_00463457 predicted 228
5 SASI_Hs02_00463458 predicted 317
6 SASI_Hs02_00463459 predicted 309
7 SASI_Hs02_00463460 predicted 230
8 SASI_Hs02_00463461 predicted 298
9 SASI_Hs02_00463462 predicted 467
10 SASI_Hs02_00463463 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480524 predicted 379
2 SASI_Hs02_00480525 predicted 298
3 SASI_Hs02_00480526 predicted 392
4 SASI_Hs01_00252443 predicted 228
5 SASI_Hs02_00480527 predicted 313
6 SASI_Hs02_00480528 predicted 309
7 SASI_Hs01_00252447 predicted 231
8 SASI_Hs02_00480529 predicted 294
9 SASI_Hs02_00480530 predicted 471
10 SASI_Hs02_00480531 predicted 312
11 SASI_Hs01_00252441 predicted 249
12 SASI_Hs01_00252442 predicted 225
13 SASI_Hs01_00252444 predicted 114
14 SASI_Hs01_00252445 predicted 263
15 SASI_Hs01_00252446 predicted 62
16 SASI_Hs01_00252448 predicted 91
17 SASI_Hs01_00252449 predicted 85
18 SASI_Hs01_00252450 predicted 122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484599 predicted 376
2 SASI_Hs02_00484600 predicted 299
3 SASI_Hs02_00484601 predicted 391
4 SASI_Hs02_00484602 predicted 230
5 SASI_Hs02_00484603 predicted 311
6 SASI_Hs02_00484604 predicted 315
7 SASI_Hs02_00484605 predicted 224
8 SASI_Hs02_00484606 predicted 297
9 SASI_Hs02_00484607 predicted 468
10 SASI_Hs02_00484608 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339971 predicted 196
2 SASI_Rn02_00339972 predicted 289
3 SASI_Rn02_00339973 predicted 282
4 SASI_Rn02_00339974 predicted 269
5 SASI_Rn02_00339975 predicted 524
6 SASI_Rn02_00339976 predicted 646
7 SASI_Rn02_00339977 predicted 40
8 SASI_Rn02_00339978 predicted 48
9 SASI_Rn02_00339979 predicted 131
10 SASI_Rn02_00339980 predicted 22
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396657 predicted 201
2 SASI_Rn02_00396658 predicted 298
3 SASI_Rn02_00396659 predicted 390
4 SASI_Rn02_00396660 predicted 285
5 SASI_Rn02_00396661 predicted 269
6 SASI_Rn02_00396662 predicted 372
7 SASI_Rn02_00396663 predicted 271
8 SASI_Rn02_00396664 predicted 523
9 SASI_Rn02_00396665 predicted 276
10 SASI_Rn02_00396666 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00375593 predicted 325
2 SASI_Mm02_00375594 predicted 316
3 SASI_Mm02_00375595 predicted 210
4 SASI_Mm02_00375596 predicted 302
5 SASI_Mm02_00375597 predicted 350
6 SASI_Mm02_00375598 predicted 300
7 SASI_Mm02_00375599 predicted 211
8 SASI_Mm02_00375600 predicted 244
9 SASI_Mm02_00375601 predicted 308
10 SASI_Mm02_00375602 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00419285 predicted 321
2 SASI_Mm02_00419286 predicted 319
3 SASI_Mm02_00419287 predicted 213
4 SASI_Mm02_00419288 predicted 300
5 SASI_Mm02_00419289 predicted 351
6 SASI_Mm02_00419290 predicted 302
7 SASI_Mm02_00419291 predicted 211
8 SASI_Mm02_00419292 predicted 241
9 SASI_Mm02_00419293 predicted 308
10 SASI_Mm02_00419294 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027771
KRTAP7-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 7-1 (gene/pseudogene)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000347865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-306s21c1
Sequence:CCGGTCGGCTACAGCACCTACTGATCTCGAGATCAGTAGGTGCTGTAGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027771.1-455s21c1
Sequence:CCGGCAGCAGGAGCCCATCTATAAACTCGAGTTTATAGATGGGCTCCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-97s21c1
Sequence:CCGGAGGGTATCCCTGCTATGGAACCTCGAGGTTCCATAGCAGGGATACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-221s21c1
Sequence:CCGGTGCTATGGTGGCATTAGTAACCTCGAGGTTACTAATGCCACCATAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027771
KRTAP7-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 7-1 (gene/pseudogene)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000347865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-306s21c1
Sequence:CCGGTCGGCTACAGCACCTACTGATCTCGAGATCAGTAGGTGCTGTAGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027771.1-455s21c1
Sequence:CCGGCAGCAGGAGCCCATCTATAAACTCGAGTTTATAGATGGGCTCCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-97s21c1
Sequence:CCGGAGGGTATCCCTGCTATGGAACCTCGAGGTTCCATAGCAGGGATACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-221s21c1
Sequence:CCGGTGCTATGGTGGCATTAGTAACCTCGAGGTTACTAATGCCACCATAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027771
KRTAP7-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 7-1 (gene/pseudogene)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000347865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-306s21c1
Sequence:CCGGTCGGCTACAGCACCTACTGATCTCGAGATCAGTAGGTGCTGTAGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027771.1-455s21c1
Sequence:CCGGCAGCAGGAGCCCATCTATAAACTCGAGTTTATAGATGGGCTCCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-97s21c1
Sequence:CCGGAGGGTATCCCTGCTATGGAACCTCGAGGTTCCATAGCAGGGATACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027771.1-221s21c1
Sequence:CCGGTGCTATGGTGGCATTAGTAACCTCGAGGTTACTAATGCCACCATAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181606
KRTAP7-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 7-1 (gene/pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-279s21c1
Sequence:CCGGTTGGCTACAGCACCTACTGATCTCGAGATCAGTAGGTGCTGTAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-66s21c1
Sequence:CCGGTCCCAGGATACCCTATCTATGCTCGAGCATAGATAGGGTATCCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-156s21c1
Sequence:CCGGACTATGGCTGTGGATGCAATGCTCGAGCATTGCATCCACAGCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-234s21c1
Sequence:CCGGGCTATGGTGGTAGCTTCTATACTCGAGTATAGAAGCTACCACCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181606.2-317s21c1
Sequence:CCGGGACTACAGGACTCTCAATTAACTCGAGTTAATTGAGAGTCCTGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181606
KRTAP7-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 7-1 (gene/pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-279s21c1
Sequence:CCGGTTGGCTACAGCACCTACTGATCTCGAGATCAGTAGGTGCTGTAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-66s21c1
Sequence:CCGGTCCCAGGATACCCTATCTATGCTCGAGCATAGATAGGGTATCCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-156s21c1
Sequence:CCGGACTATGGCTGTGGATGCAATGCTCGAGCATTGCATCCACAGCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-234s21c1
Sequence:CCGGGCTATGGTGGTAGCTTCTATACTCGAGTATAGAAGCTACCACCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181606.2-317s21c1
Sequence:CCGGGACTACAGGACTCTCAATTAACTCGAGTTAATTGAGAGTCCTGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181606
KRTAP7-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 7-1 (gene/pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-279s21c1
Sequence:CCGGTTGGCTACAGCACCTACTGATCTCGAGATCAGTAGGTGCTGTAGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-66s21c1
Sequence:CCGGTCCCAGGATACCCTATCTATGCTCGAGCATAGATAGGGTATCCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-156s21c1
Sequence:CCGGACTATGGCTGTGGATGCAATGCTCGAGCATTGCATCCACAGCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181606.2-234s21c1
Sequence:CCGGGCTATGGTGGTAGCTTCTATACTCGAGTATAGAAGCTACCACCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181606.2-317s21c1
Sequence:CCGGGACTACAGGACTCTCAATTAACTCGAGTTAATTGAGAGTCCTGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)