EMAIL THIS PAGE TO A FRIEND

KRTAP8-1

keratin associated protein 8-1

70 Gene Product Result for
Synonyms: KAP8.1
UniProtKB ID: Q8IUC2, Q3LI57
Gene ID:
Mouse(16703) keratin associated protein 8-1
Rat(100359826) keratin associated protein 8-1
dog(100687766) keratin associated protein 8-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175857 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175857 Rosetta Predictions human pricing
XM_887607 Rosetta Predictions mouse pricing
XM_917709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225815 predicted 291
2 SASI_Hs01_00225816 predicted 311
3 SASI_Hs01_00225817 predicted 196
4 SASI_Hs01_00225818 predicted 201
5 SASI_Hs01_00225819 predicted 199
6 SASI_Hs02_00369130 predicted 247
7 SASI_Hs01_00225821 predicted 329
8 SASI_Hs02_00369131 predicted 303
9 SASI_Hs01_00225822 predicted 232
10 SASI_Hs01_00225823 predicted 236
11 SASI_Hs01_00225820 predicted 203
12 SASI_Hs01_00225824 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244058 predicted 53
2 SASI_Mm01_00244059 predicted 13
3 SASI_Mm01_00244060 predicted 29
4 SASI_Mm01_00244061 predicted 82
5 SASI_Mm01_00244062 predicted 162
6 SASI_Mm01_00244063 predicted 99
7 SASI_Mm01_00244064 predicted 17
8 SASI_Mm01_00244065 predicted 74
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441353 predicted 207
2 SASI_Mm02_00441354 predicted 203
3 SASI_Mm02_00441355 predicted 203
4 SASI_Mm02_00441356 predicted 211
5 SASI_Mm02_00441357 predicted 209
6 SASI_Mm02_00441358 predicted 263
7 SASI_Mm02_00441359 predicted 301
8 SASI_Mm02_00441360 predicted 238
9 SASI_Mm02_00441361 predicted 244
10 SASI_Mm02_00441362 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175857
KRTAP8-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 8-1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175857.3-416s1c1
Sequence:CCGGGCTGATGTTCTCTGGGACATTCTCGAGAATGTCCCAGAGAACATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-203s21c1
Sequence:CCGGCTCGCCATTTGCTCTCTACTGCTCGAGCAGTAGAGAGCAAATGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-215s21c1
Sequence:CCGGTCTCTACTGATTGGCTGAAATCTCGAGATTTCAGCCAATCAGTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175857.3-311s21c1
Sequence:CCGGAGTCCTCATTTGCTCATCAACCTCGAGGTTGATGAGCAAATGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-151s21c1
Sequence:CCGGATGGCTTCGGCTATGGCTACACTCGAGTGTAGCCATAGCCGAAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-123s21c1
Sequence:CCGGTATGGCAGCACCTACTCTCCACTCGAGTGGAGAGTAGGTGCTGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-192s21c1
Sequence:CCGGTACAGGAGATACTCGCCATTTCTCGAGAAATGGCGAGTATCTCCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-88s21c1
Sequence:CCGGATGGCTACCCGCTGGGATATACTCGAGTATATCCCAGCGGGTAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175857.2-197s1c1
Sequence:CCGGGAGATACTCGCCATTTGCTCTCTCGAGAGAGCAAATGGCGAGTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-59s21c1
Sequence:CCGGTGTCTTCCCAGGATGCTACTGCTCGAGCAGTAGCATCCTGGGAAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175857
KRTAP8-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 8-1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175857.3-416s1c1
Sequence:CCGGGCTGATGTTCTCTGGGACATTCTCGAGAATGTCCCAGAGAACATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-203s21c1
Sequence:CCGGCTCGCCATTTGCTCTCTACTGCTCGAGCAGTAGAGAGCAAATGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-215s21c1
Sequence:CCGGTCTCTACTGATTGGCTGAAATCTCGAGATTTCAGCCAATCAGTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175857.3-311s21c1
Sequence:CCGGAGTCCTCATTTGCTCATCAACCTCGAGGTTGATGAGCAAATGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-151s21c1
Sequence:CCGGATGGCTTCGGCTATGGCTACACTCGAGTGTAGCCATAGCCGAAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-123s21c1
Sequence:CCGGTATGGCAGCACCTACTCTCCACTCGAGTGGAGAGTAGGTGCTGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-192s21c1
Sequence:CCGGTACAGGAGATACTCGCCATTTCTCGAGAAATGGCGAGTATCTCCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-88s21c1
Sequence:CCGGATGGCTACCCGCTGGGATATACTCGAGTATATCCCAGCGGGTAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175857.2-197s1c1
Sequence:CCGGGAGATACTCGCCATTTGCTCTCTCGAGAGAGCAAATGGCGAGTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-59s21c1
Sequence:CCGGTGTCTTCCCAGGATGCTACTGCTCGAGCAGTAGCATCCTGGGAAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175857
KRTAP8-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 8-1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175857.3-416s1c1
Sequence:CCGGGCTGATGTTCTCTGGGACATTCTCGAGAATGTCCCAGAGAACATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-203s21c1
Sequence:CCGGCTCGCCATTTGCTCTCTACTGCTCGAGCAGTAGAGAGCAAATGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-215s21c1
Sequence:CCGGTCTCTACTGATTGGCTGAAATCTCGAGATTTCAGCCAATCAGTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175857.3-311s21c1
Sequence:CCGGAGTCCTCATTTGCTCATCAACCTCGAGGTTGATGAGCAAATGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-151s21c1
Sequence:CCGGATGGCTTCGGCTATGGCTACACTCGAGTGTAGCCATAGCCGAAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-123s21c1
Sequence:CCGGTATGGCAGCACCTACTCTCCACTCGAGTGGAGAGTAGGTGCTGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-192s21c1
Sequence:CCGGTACAGGAGATACTCGCCATTTCTCGAGAAATGGCGAGTATCTCCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-88s21c1
Sequence:CCGGATGGCTACCCGCTGGGATATACTCGAGTATATCCCAGCGGGTAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175857.2-197s1c1
Sequence:CCGGGAGATACTCGCCATTTGCTCTCTCGAGAGAGCAAATGGCGAGTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175857.3-59s21c1
Sequence:CCGGTGTCTTCCCAGGATGCTACTGCTCGAGCAGTAGCATCCTGGGAAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)