EMAIL THIS PAGE TO A FRIEND

KRTAP9-1

keratin associated protein 9-1

52 Gene Product Result for
Synonyms: KAP9.1 KRTAP9L3
UniProtKB ID: A8MXZ3
Gene ID:
Mouse(16705) keratin associated protein 9-1
Rat(680328) keratin associated protein 9-1
cow(788138) keratin associated protein 9-1
cow(788186) keratin associated protein 9-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148021 MISSION® esiRNA esiRNA targeting mouse Krtap9-1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714684 Rosetta Predictions human pricing
XM_001718456 Rosetta Predictions human pricing
XM_001726986 Rosetta Predictions human pricing
XM_001056707 Rosetta Predictions rat pricing
NM_015741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398733 predicted 345
2 SASI_Hs02_00398734 predicted 353
3 SASI_Hs02_00398735 predicted 312
4 SASI_Hs02_00398736 predicted 318
5 SASI_Hs02_00398737 predicted 346
6 SASI_Hs02_00398738 predicted 313
7 SASI_Hs02_00398739 predicted 501
8 SASI_Hs02_00398740 predicted 347
9 SASI_Hs02_00398741 predicted 317
10 SASI_Hs02_00398742 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424036 predicted 353
2 SASI_Hs02_00424037 predicted 315
3 SASI_Hs02_00424038 predicted 345
4 SASI_Hs02_00424039 predicted 353
5 SASI_Hs02_00424040 predicted 321
6 SASI_Hs02_00424041 predicted 356
7 SASI_Hs02_00424042 predicted 499
8 SASI_Hs02_00424043 predicted 340
9 SASI_Hs02_00424044 predicted 495
10 SASI_Hs02_00424045 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477864 predicted 410
2 SASI_Hs02_00477865 predicted 436
3 SASI_Hs02_00477866 predicted 404
4 SASI_Hs02_00477867 predicted 446
5 SASI_Hs02_00477868 predicted 407
6 SASI_Hs02_00477869 predicted 363
7 SASI_Hs02_00477870 predicted 289
8 SASI_Hs02_00477871 predicted 199
9 SASI_Hs02_00477872 predicted 615
10 SASI_Hs02_00477873 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284159 predicted 472
2 SASI_Rn02_00284160 predicted 194
3 SASI_Rn02_00284161 predicted 490
4 SASI_Rn02_00284162 predicted 422
5 SASI_Rn02_00284163 predicted 168
6 SASI_Rn02_00284164 predicted 97
7 SASI_Rn02_00284165 predicted 176
8 SASI_Rn02_00284166 predicted 137
9 SASI_Rn02_00284167 predicted 444
10 SASI_Rn02_00284168 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156864 predicted 288
2 SASI_Mm01_00156865 predicted 293
3 SASI_Mm01_00156867 predicted 291
4 SASI_Mm01_00156866 predicted 293
5 SASI_Mm01_00156868 predicted 479
6 SASI_Mm01_00156869 predicted 421
7 SASI_Mm01_00156870 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015741
KRTAP9-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 9-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-71s1c1
Sequence:CCGGGCTGGAGACCAAGCTGTGTGACTCGAGTCACACAGCTTGGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-380s1c1
Sequence:CCGGGCTGTCAGTCTAGCTGCTGCACTCGAGTGCAGCAGCTAGACTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-146s1c1
Sequence:CCGGAGCCTTGCTGTCAAACCACTTCTCGAGAAGTGGTTTGACAGCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-332s1c1
Sequence:CCGGCCAGGTGCTGTATCTCCAGCTCTCGAGAGCTGGAGATACAGCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-272s1c1
Sequence:CCGGCCAGCTGTTGTCAGTCCAGCTCTCGAGAGCTGGACTGACAACAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015741
KRTAP9-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 9-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-71s1c1
Sequence:CCGGGCTGGAGACCAAGCTGTGTGACTCGAGTCACACAGCTTGGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-380s1c1
Sequence:CCGGGCTGTCAGTCTAGCTGCTGCACTCGAGTGCAGCAGCTAGACTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-146s1c1
Sequence:CCGGAGCCTTGCTGTCAAACCACTTCTCGAGAAGTGGTTTGACAGCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-332s1c1
Sequence:CCGGCCAGGTGCTGTATCTCCAGCTCTCGAGAGCTGGAGATACAGCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-272s1c1
Sequence:CCGGCCAGCTGTTGTCAGTCCAGCTCTCGAGAGCTGGACTGACAACAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015741
KRTAP9-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 9-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-71s1c1
Sequence:CCGGGCTGGAGACCAAGCTGTGTGACTCGAGTCACACAGCTTGGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-380s1c1
Sequence:CCGGGCTGTCAGTCTAGCTGCTGCACTCGAGTGCAGCAGCTAGACTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-146s1c1
Sequence:CCGGAGCCTTGCTGTCAAACCACTTCTCGAGAAGTGGTTTGACAGCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-332s1c1
Sequence:CCGGCCAGGTGCTGTATCTCCAGCTCTCGAGAGCTGGAGATACAGCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015741.1-272s1c1
Sequence:CCGGCCAGCTGTTGTCAGTCCAGCTCTCGAGAGCTGGACTGACAACAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)