EMAIL THIS PAGE TO A FRIEND

KRTAP9-2

keratin associated protein 9-2

8 Gene Product Result for
Synonyms: KAP9.2 KRTAP9.2
UniProtKB ID: Q9BYQ4, Q17RK8, Q2TB15
Gene ID:
Human(83899) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
cow(100138157) keratin associated protein 9-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031961 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121757 predicted 526
2 SASI_Hs01_00121758 predicted 516
3 SASI_Hs02_00359140 predicted 745
4 SASI_Hs01_00121759 predicted 945
5 SASI_Hs01_00121760 predicted 753
6 SASI_Hs02_00359141 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031961
KRTAP9-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 9-2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-802s1c1
Sequence:CCGGCAAGAGCTTCATTCCCTGCTTCTCGAGAAGCAGGGAATGAAGCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-805s1c1
Sequence:CCGGGAGCTTCATTCCCTGCTTCTACTCGAGTAGAAGCAGGGAATGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-793s1c1
Sequence:CCGGCTCTAAAGTCAAGAGCTTCATCTCGAGATGAAGCTCTTGACTTTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-784s1c1
Sequence:CCGGCAGCTTTGACTCTAAAGTCAACTCGAGTTGACTTTAGAGTCAAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-751s1c1
Sequence:CCGGGCTTCATCTGTTCTCAAGTTTCTCGAGAAACTTGAGAACAGATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-819s1c1
Sequence:CCGGGCTTCTAAGGAATTTAGGTTTCTCGAGAAACCTAAATTCCTTAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-696s1c1
Sequence:CCGGGCAGAATACTTCATCCTGATTCTCGAGAATCAGGATGAAGTATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-552s1c1
Sequence:CCGGCCATCCTCACACAACAAATTTCTCGAGAAATTTGTTGTGTGAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-890s1c1
Sequence:CCGGCCTCATCGTTCTTGTATCCTTCTCGAGAAGGATACAAGAACGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031961
KRTAP9-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 9-2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-802s1c1
Sequence:CCGGCAAGAGCTTCATTCCCTGCTTCTCGAGAAGCAGGGAATGAAGCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-805s1c1
Sequence:CCGGGAGCTTCATTCCCTGCTTCTACTCGAGTAGAAGCAGGGAATGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-793s1c1
Sequence:CCGGCTCTAAAGTCAAGAGCTTCATCTCGAGATGAAGCTCTTGACTTTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-784s1c1
Sequence:CCGGCAGCTTTGACTCTAAAGTCAACTCGAGTTGACTTTAGAGTCAAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-751s1c1
Sequence:CCGGGCTTCATCTGTTCTCAAGTTTCTCGAGAAACTTGAGAACAGATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-819s1c1
Sequence:CCGGGCTTCTAAGGAATTTAGGTTTCTCGAGAAACCTAAATTCCTTAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-696s1c1
Sequence:CCGGGCAGAATACTTCATCCTGATTCTCGAGAATCAGGATGAAGTATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-552s1c1
Sequence:CCGGCCATCCTCACACAACAAATTTCTCGAGAAATTTGTTGTGTGAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-890s1c1
Sequence:CCGGCCTCATCGTTCTTGTATCCTTCTCGAGAAGGATACAAGAACGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031961
KRTAP9-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 9-2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-802s1c1
Sequence:CCGGCAAGAGCTTCATTCCCTGCTTCTCGAGAAGCAGGGAATGAAGCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-805s1c1
Sequence:CCGGGAGCTTCATTCCCTGCTTCTACTCGAGTAGAAGCAGGGAATGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-793s1c1
Sequence:CCGGCTCTAAAGTCAAGAGCTTCATCTCGAGATGAAGCTCTTGACTTTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-784s1c1
Sequence:CCGGCAGCTTTGACTCTAAAGTCAACTCGAGTTGACTTTAGAGTCAAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-751s1c1
Sequence:CCGGGCTTCATCTGTTCTCAAGTTTCTCGAGAAACTTGAGAACAGATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-819s1c1
Sequence:CCGGGCTTCTAAGGAATTTAGGTTTCTCGAGAAACCTAAATTCCTTAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-696s1c1
Sequence:CCGGGCAGAATACTTCATCCTGATTCTCGAGAATCAGGATGAAGTATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031961.2-552s1c1
Sequence:CCGGCCATCCTCACACAACAAATTTCTCGAGAAATTTGTTGTGTGAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031961.2-890s1c1
Sequence:CCGGCCTCATCGTTCTTGTATCCTTCTCGAGAAGGATACAAGAACGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)