EMAIL THIS PAGE TO A FRIEND

KRTAP9-3

keratin associated protein 9-3

27 Gene Product Result for
Synonyms: KAP9.3 KRTAP9.3
UniProtKB ID: Q9BYQ3
Gene ID:
Human(83900) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(75586) keratin associated protein 9-3
cow(788154) uncharacterized LOC788154
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_618925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_618925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_618925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031962 Rosetta Predictions human pricing
NM_029351 Rosetta Predictions mouse pricing
XM_618925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203846 predicted 553
2 SASI_Hs02_00359142 predicted 730
3 SASI_Hs02_00359143 predicted 733
4 SASI_Hs02_00359144 predicted 732
5 SASI_Hs01_00203847 predicted 740
6 SASI_Hs01_00203848 predicted 513
7 SASI_Hs02_00359145 predicted 537
8 SASI_Hs01_00203849 predicted 831
9 SASI_Hs01_00203850 predicted 757
10 SASI_Hs02_00359146 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335210 predicted 468
2 SASI_Mm02_00335211 predicted 479
3 SASI_Mm02_00335212 predicted 473
4 SASI_Mm02_00335213 predicted 525
5 SASI_Mm02_00335214 predicted 528
6 SASI_Mm02_00335215 predicted 441
7 SASI_Mm02_00335216 predicted 463
8 SASI_Mm02_00335217 predicted 455
9 SASI_Mm02_00335218 predicted 459
10 SASI_Mm02_00335219 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_618925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219093 predicted 128
2 SASI_Mm01_00219094 predicted 136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031962
KRTAP9-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 9-3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-527s1c1
Sequence:CCGGCCAAGAGAACTACCATCCTCACTCGAGTGAGGATGGTAGTTCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-539s1c1
Sequence:CCGGCCATCCTCACACAACAACCTTCTCGAGAAGGTTGTTGTGTGAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031962.2-365s1c1
Sequence:CCGGCAAGTGTTTGTCTGCCTGGTTCTCGAGAACCAGGCAGACAAACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-708s1c1
Sequence:CCGGCTTTCCTTACACCTTGTGGATCTCGAGATCCACAAGGTGTAAGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152370    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-736s1c1
Sequence:CCGGCAGCTTCGTCTGTTCTTAATTCTCGAGAATTAAGAACAGACGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-683s1c1
Sequence:CCGGGCAGAATACTTCATCCTCATTCTCGAGAATGAGGATGAAGTATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-742s1c1
Sequence:CCGGCGTCTGTTCTTAATTTGGAGTCTCGAGACTCCAAATTAAGAACAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153475    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-735s1c1
Sequence:CCGGCCAGCTTCGTCTGTTCTTAATCTCGAGATTAAGAACAGACGAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031962.2-454s21c1
Sequence:CCCGTGCTGCAGGACCACTTGTTTCCTCGAGGAAACAAGTGGTCCTGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031962.2-580s21c1
Sequence:CCAGTTGAGGGACTAATTTACTTTGCTCGAGCAAAGTAAATTAGTCCCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031962.2-504s21c1
Sequence:CCGGGCCTTCTTGCTGCTAATCAACCTCGAGGTTGATTAGCAGCAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031962.2-801s21c1
Sequence:CCGGTCTTTGCTTCTAAGGAATTTACTCGAGTAAATTCCTTAGAAGCAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031962
KRTAP9-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 9-3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-527s1c1
Sequence:CCGGCCAAGAGAACTACCATCCTCACTCGAGTGAGGATGGTAGTTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-539s1c1
Sequence:CCGGCCATCCTCACACAACAACCTTCTCGAGAAGGTTGTTGTGTGAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031962.2-365s1c1
Sequence:CCGGCAAGTGTTTGTCTGCCTGGTTCTCGAGAACCAGGCAGACAAACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-708s1c1
Sequence:CCGGCTTTCCTTACACCTTGTGGATCTCGAGATCCACAAGGTGTAAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152370    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-736s1c1
Sequence:CCGGCAGCTTCGTCTGTTCTTAATTCTCGAGAATTAAGAACAGACGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-683s1c1
Sequence:CCGGGCAGAATACTTCATCCTCATTCTCGAGAATGAGGATGAAGTATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-742s1c1
Sequence:CCGGCGTCTGTTCTTAATTTGGAGTCTCGAGACTCCAAATTAAGAACAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153475    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-735s1c1
Sequence:CCGGCCAGCTTCGTCTGTTCTTAATCTCGAGATTAAGAACAGACGAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031962.2-454s21c1
Sequence:CCCGTGCTGCAGGACCACTTGTTTCCTCGAGGAAACAAGTGGTCCTGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031962.2-580s21c1
Sequence:CCAGTTGAGGGACTAATTTACTTTGCTCGAGCAAAGTAAATTAGTCCCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031962.2-504s21c1
Sequence:CCGGGCCTTCTTGCTGCTAATCAACCTCGAGGTTGATTAGCAGCAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031962.2-801s21c1
Sequence:CCGGTCTTTGCTTCTAAGGAATTTACTCGAGTAAATTCCTTAGAAGCAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031962
KRTAP9-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 9-3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-527s1c1
Sequence:CCGGCCAAGAGAACTACCATCCTCACTCGAGTGAGGATGGTAGTTCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-539s1c1
Sequence:CCGGCCATCCTCACACAACAACCTTCTCGAGAAGGTTGTTGTGTGAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031962.2-365s1c1
Sequence:CCGGCAAGTGTTTGTCTGCCTGGTTCTCGAGAACCAGGCAGACAAACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-708s1c1
Sequence:CCGGCTTTCCTTACACCTTGTGGATCTCGAGATCCACAAGGTGTAAGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152370    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-736s1c1
Sequence:CCGGCAGCTTCGTCTGTTCTTAATTCTCGAGAATTAAGAACAGACGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-683s1c1
Sequence:CCGGGCAGAATACTTCATCCTCATTCTCGAGAATGAGGATGAAGTATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031962.2-742s1c1
Sequence:CCGGCGTCTGTTCTTAATTTGGAGTCTCGAGACTCCAAATTAAGAACAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153475    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031962.2-735s1c1
Sequence:CCGGCCAGCTTCGTCTGTTCTTAATCTCGAGATTAAGAACAGACGAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031962.2-454s21c1
Sequence:CCCGTGCTGCAGGACCACTTGTTTCCTCGAGGAAACAAGTGGTCCTGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031962.2-580s21c1
Sequence:CCAGTTGAGGGACTAATTTACTTTGCTCGAGCAAAGTAAATTAGTCCCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031962.2-504s21c1
Sequence:CCGGGCCTTCTTGCTGCTAATCAACCTCGAGGTTGATTAGCAGCAAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031962.2-801s21c1
Sequence:CCGGTCTTTGCTTCTAAGGAATTTACTCGAGTAAATTCCTTAGAAGCAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029351
KRTAP9-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 9-3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000202778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-545s1c1
Sequence:CCGGCAGTATTGATAACTCAGCTATCTCGAGATAGCTGAGTTATCAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-484s1c1
Sequence:CCGGCTTAGGAAGATGACACTTCAACTCGAGTTGAAGTGTCATCTTCCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-561s1c1
Sequence:CCGGGCTATTGACACGGCTACATAACTCGAGTTATGTAGCCGTGTCAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029351
KRTAP9-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 9-3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000202778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-545s1c1
Sequence:CCGGCAGTATTGATAACTCAGCTATCTCGAGATAGCTGAGTTATCAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-484s1c1
Sequence:CCGGCTTAGGAAGATGACACTTCAACTCGAGTTGAAGTGTCATCTTCCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-561s1c1
Sequence:CCGGGCTATTGACACGGCTACATAACTCGAGTTATGTAGCCGTGTCAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029351
KRTAP9-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 9-3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000202778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-545s1c1
Sequence:CCGGCAGTATTGATAACTCAGCTATCTCGAGATAGCTGAGTTATCAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-484s1c1
Sequence:CCGGCTTAGGAAGATGACACTTCAACTCGAGTTGAAGTGTCATCTTCCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029351.1-561s1c1
Sequence:CCGGGCTATTGACACGGCTACATAACTCGAGTTATGTAGCCGTGTCAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_618925
KRTAP9-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 9-3
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000204714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_618925.1-112s1c1
Sequence:CCGGGCTACAAGCTTCTGTGGCTTTCTCGAGAAAGCCACAGAAGCTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_618925
KRTAP9-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 9-3
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000204714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_618925.1-112s1c1
Sequence:CCGGGCTACAAGCTTCTGTGGCTTTCTCGAGAAAGCCACAGAAGCTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_618925
KRTAP9-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 9-3
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000204714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_618925.1-112s1c1
Sequence:CCGGGCTACAAGCTTCTGTGGCTTTCTCGAGAAAGCCACAGAAGCTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)