EMAIL THIS PAGE TO A FRIEND

KRTAP9-8

keratin associated protein 9-8

12 Gene Product Result for
Synonyms: KAP9.8 KRTAP9.8
Species: Human KRTAP9-8(83901)
UniProtKB ID: Q9BYQ0
Gene ID:
Human(83901) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031963 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031963 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359147 predicted 531
2 SASI_Hs02_00359148 predicted 545
3 SASI_Hs02_00359149 predicted 504
4 SASI_Hs02_00359150 predicted 539
5 SASI_Hs02_00359151 predicted 501
6 SASI_Hs02_00359152 predicted 536
7 SASI_Hs02_00359153 predicted 543
8 SASI_Hs02_00359154 predicted 549
9 SASI_Hs02_00359155 predicted 361
10 SASI_Hs02_00359156 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031963
KRTAP9-8 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 9-8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-332s21c1
Sequence:CCGGTACTGCAGAAGAACCTGCTACCTCGAGGTAGCAGGTTCTTCTGCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-367s21c1
Sequence:CCGGCTGCCTGCCTGGTTGCCTAAACTCGAGTTTAGGCAACCAGGCAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031963.2-608s21c1
Sequence:CCGGACCATGCTCTCACCCAAATTTCTCGAGAAATTTGGGTGAGAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-321s21c1
Sequence:CCGGGTGCACCTGTGTACTGCAGAACTCGAGTTCTGCAGTACACAGGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-502s21c1
Sequence:CCGGTTCTTGCTGCTGATCACGTTCCTCGAGGAACGTGATCAGCAGCAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031963
KRTAP9-8 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 9-8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-332s21c1
Sequence:CCGGTACTGCAGAAGAACCTGCTACCTCGAGGTAGCAGGTTCTTCTGCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-367s21c1
Sequence:CCGGCTGCCTGCCTGGTTGCCTAAACTCGAGTTTAGGCAACCAGGCAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031963.2-608s21c1
Sequence:CCGGACCATGCTCTCACCCAAATTTCTCGAGAAATTTGGGTGAGAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-321s21c1
Sequence:CCGGGTGCACCTGTGTACTGCAGAACTCGAGTTCTGCAGTACACAGGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-502s21c1
Sequence:CCGGTTCTTGCTGCTGATCACGTTCCTCGAGGAACGTGATCAGCAGCAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031963
KRTAP9-8 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 9-8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-332s21c1
Sequence:CCGGTACTGCAGAAGAACCTGCTACCTCGAGGTAGCAGGTTCTTCTGCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-367s21c1
Sequence:CCGGCTGCCTGCCTGGTTGCCTAAACTCGAGTTTAGGCAACCAGGCAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031963.2-608s21c1
Sequence:CCGGACCATGCTCTCACCCAAATTTCTCGAGAAATTTGGGTGAGAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-321s21c1
Sequence:CCGGGTGCACCTGTGTACTGCAGAACTCGAGTTCTGCAGTACACAGGTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031963.2-502s21c1
Sequence:CCGGTTCTTGCTGCTGATCACGTTCCTCGAGGAACGTGATCAGCAGCAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)