EMAIL THIS PAGE TO A FRIEND

KRTCAP3

keratinocyte associated protein 3

58 Gene Product Result for
Synonyms: KCP3 MRV222 PRO9898
UniProtKB ID: Q53RY4, B7ZL49, Q6UW42, Q8IWS5
Gene ID:
Mouse(69815) keratinocyte associated protein 3
Rat(683980) keratinocyte associated protein 3
sheep(101112044) keratinocyte associated protein 3
domestic guinea pig(100733803) keratinocyte associated protein 3
naked mole-rat(101717247) keratinocyte associated protein 3
chicken(421984) keratinocyte associated protein 3
dog(611074) keratinocyte associated protein 3
domestic cat(101096720) keratinocyte associated protein 3
cow(508550) keratinocyte associated protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173853 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155301 MISSION® esiRNA esiRNA human KRTCAP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173853 Rosetta Predictions human pricing
NM_001109674 Rosetta Predictions rat pricing
NM_027221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135944 predicted 378
2 SASI_Hs01_00135945 predicted 225
3 SASI_Hs01_00135947 predicted 300
4 SASI_Hs01_00135948 predicted 228
5 SASI_Hs01_00135949 predicted 550
6 SASI_Hs01_00135950 predicted 298
7 SASI_Hs01_00135951 predicted 322
8 SASI_Hs01_00135952 predicted 394
9 SASI_Hs01_00135953 predicted 228
10 SASI_Hs02_00368731 predicted 259
11 SASI_Hs01_00135946 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250602 predicted 485
2 SASI_Rn02_00250603 predicted 580
3 SASI_Rn02_00250604 predicted 328
4 SASI_Rn02_00250605 predicted 648
5 SASI_Rn02_00250606 predicted 296
6 SASI_Rn02_00250607 predicted 580
7 SASI_Rn02_00250608 predicted 734
8 SASI_Rn02_00250609 predicted 279
9 SASI_Rn02_00250610 predicted 305
10 SASI_Rn02_00250611 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165240 predicted 443
2 SASI_Mm01_00165241 predicted 291
3 SASI_Mm01_00165242 predicted 251
4 SASI_Mm01_00165244 predicted 542
5 SASI_Mm01_00165245 predicted 530
6 SASI_Mm01_00165248 predicted 266
7 SASI_Mm01_00165249 predicted 286
8 SASI_Mm02_00331775 predicted 437
9 SASI_Mm02_00331776 predicted 550
10 SASI_Mm02_00331777 predicted 458
11 SASI_Mm01_00165243 predicted 456
12 SASI_Mm01_00165246 predicted 336
13 SASI_Mm01_00165247 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027221
KRTCAP3 MISSION shRNA Bacterial Glycerol Stock
keratinocyte associated protein 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-628s1c1
Sequence:CCGGCTTGAACTTCCCGAGTGTAAACTCGAGTTTACACTCGGGAAGTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-254s1c1
Sequence:CCGGCCAATGTCATTTCTGTGGGTTCTCGAGAACCCACAGAAATGACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-526s1c1
Sequence:CCGGGCTGCTCTTTCTGGTTACTGTCTCGAGACAGTAACCAGAAAGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-460s1c1
Sequence:CCGGCCCACAAGAATTTATGATACACTCGAGTGTATCATAAATTCTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027221
KRTCAP3 MISSION shRNA shRNA Plasmid DNA
keratinocyte associated protein 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-628s1c1
Sequence:CCGGCTTGAACTTCCCGAGTGTAAACTCGAGTTTACACTCGGGAAGTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-254s1c1
Sequence:CCGGCCAATGTCATTTCTGTGGGTTCTCGAGAACCCACAGAAATGACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-526s1c1
Sequence:CCGGGCTGCTCTTTCTGGTTACTGTCTCGAGACAGTAACCAGAAAGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-460s1c1
Sequence:CCGGCCCACAAGAATTTATGATACACTCGAGTGTATCATAAATTCTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027221
KRTCAP3 MISSION shRNA Lentiviral Transduction Particles
keratinocyte associated protein 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-628s1c1
Sequence:CCGGCTTGAACTTCCCGAGTGTAAACTCGAGTTTACACTCGGGAAGTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-254s1c1
Sequence:CCGGCCAATGTCATTTCTGTGGGTTCTCGAGAACCCACAGAAATGACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-526s1c1
Sequence:CCGGGCTGCTCTTTCTGGTTACTGTCTCGAGACAGTAACCAGAAAGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027221.1-460s1c1
Sequence:CCGGCCCACAAGAATTTATGATACACTCGAGTGTATCATAAATTCTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173853
KRTCAP3 MISSION shRNA Bacterial Glycerol Stock
keratinocyte associated protein 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-194s1c1
Sequence:CCGGCGTAGCCAATGTCATCTCTGTCTCGAGACAGAGATGACATTGGCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-636s1c1
Sequence:CCGGGAGGAAATGACAGAGCTCGAACTCGAGTTCGAGCTCTGTCATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-718s1c1
Sequence:CCGGCATCACAGAGAAGTTGGGTTTCTCGAGAAACCCAACTTCTCTGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-650s1c1
Sequence:CCGGGCTCGAATCTCCTAAATGTAACTCGAGTTACATTTAGGAGATTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-483s1c1
Sequence:CCGGCCCACAAGAATCTATGATACACTCGAGTGTATCATAGATTCTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-188s1c1
Sequence:CCGGGTACACCGTAGCCAATGTCATCTCGAGATGACATTGGCTACGGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-494s1c1
Sequence:CCGGCTATGATACAGCCTTGGCTCTCTCGAGAGAGCCAAGGCTGTATCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-632s1c1
Sequence:CCGGGCTAGAGGAAATGACAGAGCTCTCGAGAGCTCTGTCATTTCCTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-575s21c1
Sequence:CCGGGGAGGCTGCTCTATCTGGTTACTCGAGTAACCAGATAGAGCAGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-712s21c1
Sequence:CCGGATGAGCAGCTACTGGATCAAACTCGAGTTTGATCCAGTAGCTGCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-547s21c1
Sequence:CCCGGGATCCCTTCTTTGCTCATGTCTCGAGACATGAGCAAAGAAGGGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-677s21c1
Sequence:CCGGAGAGCTTGAATCTCCTAAATGCTCGAGCATTTAGGAGATTCAAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173853
KRTCAP3 MISSION shRNA shRNA Plasmid DNA
keratinocyte associated protein 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-194s1c1
Sequence:CCGGCGTAGCCAATGTCATCTCTGTCTCGAGACAGAGATGACATTGGCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-636s1c1
Sequence:CCGGGAGGAAATGACAGAGCTCGAACTCGAGTTCGAGCTCTGTCATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-718s1c1
Sequence:CCGGCATCACAGAGAAGTTGGGTTTCTCGAGAAACCCAACTTCTCTGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-650s1c1
Sequence:CCGGGCTCGAATCTCCTAAATGTAACTCGAGTTACATTTAGGAGATTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-483s1c1
Sequence:CCGGCCCACAAGAATCTATGATACACTCGAGTGTATCATAGATTCTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-188s1c1
Sequence:CCGGGTACACCGTAGCCAATGTCATCTCGAGATGACATTGGCTACGGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-494s1c1
Sequence:CCGGCTATGATACAGCCTTGGCTCTCTCGAGAGAGCCAAGGCTGTATCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-632s1c1
Sequence:CCGGGCTAGAGGAAATGACAGAGCTCTCGAGAGCTCTGTCATTTCCTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-575s21c1
Sequence:CCGGGGAGGCTGCTCTATCTGGTTACTCGAGTAACCAGATAGAGCAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-712s21c1
Sequence:CCGGATGAGCAGCTACTGGATCAAACTCGAGTTTGATCCAGTAGCTGCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-547s21c1
Sequence:CCCGGGATCCCTTCTTTGCTCATGTCTCGAGACATGAGCAAAGAAGGGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-677s21c1
Sequence:CCGGAGAGCTTGAATCTCCTAAATGCTCGAGCATTTAGGAGATTCAAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173853
KRTCAP3 MISSION shRNA Lentiviral Transduction Particles
keratinocyte associated protein 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-194s1c1
Sequence:CCGGCGTAGCCAATGTCATCTCTGTCTCGAGACAGAGATGACATTGGCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-636s1c1
Sequence:CCGGGAGGAAATGACAGAGCTCGAACTCGAGTTCGAGCTCTGTCATTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-718s1c1
Sequence:CCGGCATCACAGAGAAGTTGGGTTTCTCGAGAAACCCAACTTCTCTGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-650s1c1
Sequence:CCGGGCTCGAATCTCCTAAATGTAACTCGAGTTACATTTAGGAGATTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-483s1c1
Sequence:CCGGCCCACAAGAATCTATGATACACTCGAGTGTATCATAGATTCTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-188s1c1
Sequence:CCGGGTACACCGTAGCCAATGTCATCTCGAGATGACATTGGCTACGGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-494s1c1
Sequence:CCGGCTATGATACAGCCTTGGCTCTCTCGAGAGAGCCAAGGCTGTATCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173853.2-632s1c1
Sequence:CCGGGCTAGAGGAAATGACAGAGCTCTCGAGAGCTCTGTCATTTCCTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-575s21c1
Sequence:CCGGGGAGGCTGCTCTATCTGGTTACTCGAGTAACCAGATAGAGCAGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-712s21c1
Sequence:CCGGATGAGCAGCTACTGGATCAAACTCGAGTTTGATCCAGTAGCTGCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-547s21c1
Sequence:CCCGGGATCCCTTCTTTGCTCATGTCTCGAGACATGAGCAAAGAAGGGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173853.3-677s21c1
Sequence:CCGGAGAGCTTGAATCTCCTAAATGCTCGAGCATTTAGGAGATTCAAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)