EMAIL THIS PAGE TO A FRIEND

KRTDAP

keratinocyte differentiation-associated protein

35 Gene Product Result for
Synonyms: KDAP UNQ467
UniProtKB ID: P60985, A1L4D7
Gene ID:
Human(388533) Summary: This gene encodes a protein which may function in the regulation of keratinocyte differentiation and maintenance of stratified epithelia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(64661) keratinocyte differentiation associated protein
Rat(65186) keratinocyte differentiation associated protein
dog(554216) keratinocyte differentiation-associated protein
cow(504775) keratinocyte differentiation-associated protein
domestic cat(101083384) keratinocyte differentiation-associated protein
sheep(101107125) keratinocyte differentiation-associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207392 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207392 Rosetta Predictions human pricing
NM_001033131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200927 predicted 174
2 SASI_Hs01_00200928 predicted 163
3 SASI_Hs01_00200929 predicted 120
4 SASI_Hs01_00200930 predicted 101
5 SASI_Hs01_00200931 predicted 176
6 SASI_Hs01_00200933 predicted 250
7 SASI_Hs01_00200934 predicted 304
8 SASI_Hs02_00373996 predicted 232
9 SASI_Hs01_00200935 predicted 175
10 SASI_Hs01_00200936 predicted 175
11 SASI_Hs01_00200932 predicted 178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086962 predicted 230
2 SASI_Mm01_00086963 predicted 221
3 SASI_Mm01_00086964 predicted 224
4 SASI_Mm01_00086965 predicted 229
5 SASI_Mm01_00086966 predicted 228
6 SASI_Mm01_00086967 predicted 216
7 SASI_Mm01_00086968 predicted 213
8 SASI_Mm01_00086969 predicted 230
9 SASI_Mm01_00086970 predicted 111
10 SASI_Mm02_00288205 predicted 150
11 SASI_Mm01_00086971 predicted 119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207392
KRTDAP MISSION shRNA Bacterial Glycerol Stock
keratinocyte differentiation-associated protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-152s21c1
Sequence:CCGGCGTTCCTGAACATCGACAAATCTCGAGATTTGTCGATGTTCAGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-211s21c1
Sequence:CCGGCACGCCCTCTTTGAGTCTATCCTCGAGGATAGACTCAAAGAGGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-97s21c1
Sequence:CCGGGAGGAAGAAAGCACCATTGAGCTCGAGCTCAATGGTGCTTTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-180s21c1
Sequence:CCGGTGCGTTTAAGGCTGATGAGTTCTCGAGAACTCATCAGCCTTAAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-126s21c1
Sequence:CCGGGTCACGACCCGAGGCCTTTAACTCGAGTTAAAGGCCTCGGGTCGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-165s1c1
Sequence:CCGGCGACAAATTGCGATCTGCGTTCTCGAGAACGCAGATCGCAATTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-107s1c1
Sequence:CCGGGCACCATTGAGAATTATGCGTCTCGAGACGCATAATTCTCAATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-103s1c1
Sequence:CCGGGAAAGCACCATTGAGAATTATCTCGAGATAATTCTCAATGGTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207392
KRTDAP MISSION shRNA shRNA Plasmid DNA
keratinocyte differentiation-associated protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-152s21c1
Sequence:CCGGCGTTCCTGAACATCGACAAATCTCGAGATTTGTCGATGTTCAGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-211s21c1
Sequence:CCGGCACGCCCTCTTTGAGTCTATCCTCGAGGATAGACTCAAAGAGGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-97s21c1
Sequence:CCGGGAGGAAGAAAGCACCATTGAGCTCGAGCTCAATGGTGCTTTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-180s21c1
Sequence:CCGGTGCGTTTAAGGCTGATGAGTTCTCGAGAACTCATCAGCCTTAAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-126s21c1
Sequence:CCGGGTCACGACCCGAGGCCTTTAACTCGAGTTAAAGGCCTCGGGTCGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-165s1c1
Sequence:CCGGCGACAAATTGCGATCTGCGTTCTCGAGAACGCAGATCGCAATTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-107s1c1
Sequence:CCGGGCACCATTGAGAATTATGCGTCTCGAGACGCATAATTCTCAATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-103s1c1
Sequence:CCGGGAAAGCACCATTGAGAATTATCTCGAGATAATTCTCAATGGTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207392
KRTDAP MISSION shRNA Lentiviral Transduction Particles
keratinocyte differentiation-associated protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-152s21c1
Sequence:CCGGCGTTCCTGAACATCGACAAATCTCGAGATTTGTCGATGTTCAGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-211s21c1
Sequence:CCGGCACGCCCTCTTTGAGTCTATCCTCGAGGATAGACTCAAAGAGGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-97s21c1
Sequence:CCGGGAGGAAGAAAGCACCATTGAGCTCGAGCTCAATGGTGCTTTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-180s21c1
Sequence:CCGGTGCGTTTAAGGCTGATGAGTTCTCGAGAACTCATCAGCCTTAAACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207392.1-126s21c1
Sequence:CCGGGTCACGACCCGAGGCCTTTAACTCGAGTTAAAGGCCTCGGGTCGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-165s1c1
Sequence:CCGGCGACAAATTGCGATCTGCGTTCTCGAGAACGCAGATCGCAATTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-107s1c1
Sequence:CCGGGCACCATTGAGAATTATGCGTCTCGAGACGCATAATTCTCAATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207392.1-103s1c1
Sequence:CCGGGAAAGCACCATTGAGAATTATCTCGAGATAATTCTCAATGGTGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033131
KRTDAP MISSION shRNA Bacterial Glycerol Stock
keratinocyte differentiation-associated protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-119s21c1
Sequence:CCGGGAAGATAGCAGCTACAATAATCTCGAGATTATTGTAGCTGCTATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-279s21c1
Sequence:CCGGACTTCTTCCCTAAGGTGAAAGCTCGAGCTTTCACCTTAGGGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-145s21c1
Sequence:CCGGTACCGCAACAGAGGGCCTTAACTCGAGTTAAGGCCCTCTGTTGCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-53s21c1
Sequence:CCGGCTCCTCTCTCTTCTGGCATTGCTCGAGCAATGCCAGAAGAGAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-228s21c1
Sequence:CCGGGGCACGTCATCACTGATATGTCTCGAGACATATCAGTGATGACGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033131
KRTDAP MISSION shRNA shRNA Plasmid DNA
keratinocyte differentiation-associated protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-119s21c1
Sequence:CCGGGAAGATAGCAGCTACAATAATCTCGAGATTATTGTAGCTGCTATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-279s21c1
Sequence:CCGGACTTCTTCCCTAAGGTGAAAGCTCGAGCTTTCACCTTAGGGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-145s21c1
Sequence:CCGGTACCGCAACAGAGGGCCTTAACTCGAGTTAAGGCCCTCTGTTGCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-53s21c1
Sequence:CCGGCTCCTCTCTCTTCTGGCATTGCTCGAGCAATGCCAGAAGAGAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-228s21c1
Sequence:CCGGGGCACGTCATCACTGATATGTCTCGAGACATATCAGTGATGACGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033131
KRTDAP MISSION shRNA Lentiviral Transduction Particles
keratinocyte differentiation-associated protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-119s21c1
Sequence:CCGGGAAGATAGCAGCTACAATAATCTCGAGATTATTGTAGCTGCTATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-279s21c1
Sequence:CCGGACTTCTTCCCTAAGGTGAAAGCTCGAGCTTTCACCTTAGGGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-145s21c1
Sequence:CCGGTACCGCAACAGAGGGCCTTAACTCGAGTTAAGGCCCTCTGTTGCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-53s21c1
Sequence:CCGGCTCCTCTCTCTTCTGGCATTGCTCGAGCAATGCCAGAAGAGAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033131.3-228s21c1
Sequence:CCGGGGCACGTCATCACTGATATGTCTCGAGACATATCAGTGATGACGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)